ABSTRACT Petri disease is a problem for vineyard caused mainly by the fungus Phaeomoniella chlamydospora. Contaminated seedlings are source of inoculum for the disease. Treatment to disinfect vine rootstock cuttings for seedling production is hot water treatment (HWT) by 50 °C for 30 min, but the efficiency is contested. To improve its efficacy, the study aimed to assess the combination of the following methods and the reason for the control: i) exposition of the fungus to five different temperatures in HWT bath for 30 min; ii and iii) exposition of the fungus and also plants infected with P. chlamydospora to different disinfection treatments (biofumigation = soil + cabbage at 40 °C; temperatures of 40 and 23 °C, all in microcosm), in different periods (7, 14 and 21 days), with and without additional HWT (51 °C for 30 min). The results showed that HWT with high temperatures (55–70 °C) for 30 min inactivated the fungus. Biofumigation technique at 40 °C and the temperature solely of 40 °C applied for up to 21 days and combined with HWT (51 °C for 30 min) inhibited mycelial growth and inactivated the fungus in vine plant tissues without compromising the rooting.

RESUMO: As enzimas extracelulares estão envolvidas na patogênese de fungos em plantas. Atualmente, não há uma padronização de meios de cultura, formas de analisar e divulgar os dados de enzimas extracelulares produzidas em condições in vitro. Assim, o presente trabalho objetivou comparar os meios de cultura específicos relatados na literatura (normal) com o meio de batata-dextrose-ágar mais adição do substrato específico para produção de enzimas extracelulares por três diferentes fungos fitopatogênicos habitantes de solo (Fusarium solani f. sp. passiflorae, Sclerotium rolfsii e Rhizoctonia solani AG-4 HGI), bem como avaliar os dados das enzimas por cinco critérios diferentes. O delineamento experimental adotado foi o inteiramente ao acaso, em esquema de três fatores (meios, isolados e enzimas), com seis repetições. As enzimas investigadas foram amilase, carboximetilcelulase, lipase, lacase, catalase e gelatinase. Os meios normais detectaram mais enzimas, e essa detecção foi mais precisa em comparação com os meios de batata-dextrose-ágar mais o substrato específico. Os critérios que calcularam a área da coroa circular para as enzimas amilase, carboximetilcelulase, lipase e lacase e adotaram a escala de notas para medir a intensidade (0=ausência até 4=intensa) de catalase e gelatinase foram os melhores para avaliar e divulgar os resultados das enzimas. Assim, sugere-se padronizar os meios normais para estudos de produção de enzimas, bem como os critérios citados para avaliar e divulgar os dados das atividades das referidas enzimas.

ABSTRACT: Extracellular enzymes are involved in the fungal pathogenesis in plants. Currently, culture media, data analyses, and data report related to extracellular enzymes produced in vitro conditions are different and therefore, lack standardization. This work aimed to compare the culture media cited on the literature (normal) with the potato-dextrose-agar (PDA) medium combined with a specific compound to produce extracellular enzymes through three soilborne phytopathogenic fungi (F. solani f. sp. passiflorae, S. rolfsii, and R. solani AG-4 HGI), as well as to analyze and report enzyme data based on five different criteria. The assay was randomized, with three factors (culture media, isolates, and enzymes) and six repetitions. The studied enzymes were amylase (AM), carboxymethylcellulase (CMCase), lipase (LP), laccase (LC), catalase (CT), and gelatinase (GT). The normal media detected more enzymes and was more precise compared to the PDA medium plus specific compound. The criteria that calculated the area of the circular crown of AM, CMCase, LP, and LC and measured the intensity (0 = absence, up to 4 = intense) of CT and GT adopting note scale were the best to evaluate and report the results of the enzymes. We suggest the normal media culture to study enzyme production, as well as the criteria mentioned to assess and report the data related to enzyme activities.

RESUMO A doença de Petri é grave, complexa e de difícil controle em videiras no mundo. O principal agente causal desta doença é o fungo Phaeomoniella chlamydospora. Este fungo ocorre também na planta daninha de vinhedo Convolvulus arvensis. No Brasil, este fungo foi encontrado somente em videiras. Assim, o objetivo do presente estudo foi efetuar um levantamento fitossociológico de plantas daninhas em uma área com diferentes cavalos de videiras, em um campo de produção de mudas, em uma área experimental com videira e em diferentes áreas com plantio comercial de videira e verificar quais espécies poderiam estar hospedando o fungo P. chlamydospora. Para o levantamento fitossociológico das plantas daninhas, lançava-se um quadrado ao acaso, por dez vezes, no local, contando, identificando e amostrando todas as espécies. Para verificar as espécies hospedeiras do fungo, realizou-se isolamento do tecido vascular das plantas em meios de cultura e extração de DNA do mesmo tecido vegetal seguido de PCR com primers específicos do fungo do gene do fator de elongação (Pchlamy-EF-F 5’-CTCATTATCACATTTTGCTGC-3’ e Pchlamy-EF-R 5’-GAGAACAGTCAGTGATGAGC-3’). Em todo o levantamento, foram detectadas 46 espécies de plantas daninhas em 17 famílias, destacando-se as famílias Asteraceae e Poaceae com o maior número de espécies cada. Não foi detectado de maneira convencional e nem molecularmente o fungo P. chlamydospora infectando plantas daninhas, ressaltando a ocorrência da doença de Petri apenas em videiras.

ABSTRACT Petri disease is serious, complex and difficult to control in vines worldwide. The main causal agent of this disease is the fungus Phaeomoniella chlamydospora. This fungus also occurs in the vineyard weed Convolvulus arvensis. In Brazil, this fungus was found only in grapevines. Thus, the aim of the present study was to carry out a phytosociological survey of weeds in an area with different vine rootstocks, as well as in a field of seedlings production, in an experimental area with vines and in different areas with commercial vineyards, besides verifying which weed species could be hosting the fungus P. chlamydospora. For the phytosociological survey of weeds, a square was randomly cast ten times at the site, followed by counting, identification and sampling of all species. To verify host species of the fungus, vascular tissue of plants was isolated in culture media and DNA extraction from the same plant tissue was carried out followed by PCR with specific primers of the fungus for the elongation factor gene (Pchlamy-EF-F 5’-CTCATTATCACATTTTGCTGC-3’ and Pchlamy-EF-R 5’-GAGAACAGTCAGTGATGAGC-3’). Considering all surveyed fields, 46 weed species were detected in 17 families, especially Asteraceae and Poaceae, which had the largest number of species. Using conventional or molecular methods, the fungus P. chlamydospora was not detected infecting weeds, which highlights that Petri disease occurs only in grapevines.

RESUMO: A broca-do-cupuaçu, Conotrachelus humeropictus, é uma das principais pragas da cultura, podendo ocasionar perdas de 50% na produção. O presente trabalho envolveu uma seleção prévia de isolados de Beauveria bassiana em larvas de Conotrachelus psidii, utilizado como inseto teste por ser próximo taxonomicamente à C. humeropictus. Com o objetivo de avaliar causa-efeitos da interação na aplicação combinada, foi estudada a capacidade do nematoide carrear conídios de B. bassiana e Metarhizium anisopliae pelas camadas de solo. O trabalho também objetivou avaliar o controle biológico da broca-do-cupuaçu, através do uso do fungo B. bassiana 10 kg/ha, e do nematoide entomopatogênico Steinernema brazilense 1, 3, 9 e 27 JI/cm2, aplicados em tratamentos isolados e em combinação. Na seleção de isolados de B. bassiana para C. psidii, os isolados IBCB 276 e IBCB 165 foram os mais promissores, causando, respectivamente, 86 e 84% de mortalidade confirmada. O isolado IBCB 276 foi aplicado em campo para controlar C. humeropictus. No estudo de carreamento de conídios, o nematoide S. brazilense foi capaz de carrear conídios de B. bassiana para a camada de 7 a 10 cm de profundidade no solo. A mesma ação não foi observada com M. anisopliae, encontrado somente na camada superficial do solo. Nos ensaios de campo contra C. humeropictus, B. bassiana promoveu 15,6% de mortalidade. O nematoide promoveu 60,0% de mortalidade na maior concentração utilizada e, na combinação dessa concentração do NEP com B. bassiana (10 kg/ha), a mortalidade atingiu 65,6%, observando-se interação aditiva entre os dois entomopatógenos.

ABSTRACT: The fruit borer Conotrachelus humeropictus is one of the most important pests of the cupuaçu crop, and can promote yield losses of around 50%. The present study involved the selection of Beauveria bassiana isolates on Conotrachelus psidii larvae, which was used as test insect due to its taxonomic closeness to C. humeropictus. In order to assess their interaction using combined application, we studied the ability of the nematode to carry conidia of B. bassiana and Metarhizium anisopliae to soil layers. This study also aimed to establish a biological control method for cupuaçu borer with the use of the fungus B. bassiana at 10 kg/ha and the entomopathogenic nematode Steinernema brazilense at 1, 3, 9, and 27 IJ/cm2, applied as single and combined treatments. In the selection of B. bassiana strains for C. psidii, the IBCB 276 and IBCB 165 isolates were the most promising ones, causing 86 and 84% mortality, respectively. The IBCB 276 strain was applied in the field to control C. humeropictus. In the study of carriage of conidia in soil, the nematode S. brazilense was found to be capable of carrying conidia of B. bassiana to deep 7 to 10 cm soil layers. This was not observed with M. anisopliae, found only in the topsoil. In field trials against C. humeropictus larvae, B. bassiana promoted 15.6% mortality. The nematode promoted 60.0% mortality at the highest concentration used, and their combined use with B. bassiana (10 kg/ha) increased mortality to 65.6%, with an additive interaction observed between the two entomopathogens.

RESUMO: As formigas-cortadeiras (Hymenoptera: Formicidae) evoluíram estabelecendo-se no continente americano como herbívoros dominantes. Esses insetos sociais praticam a desfolha de espécies vegetais de interesse econômico, com a finalidade de manter a reserva alimentar da colônia, o fungo simbionte Leucocoprinus gongylophorus, um basidiomiceto. Tal fungo pode ser alvo de aplicações de moléculas fungicidas encontradas em metabólitos gerados por bactérias simbiontes (Xenorhabdus e Photorhabdus) de nematoides entomopatogênicos (Steinernema e Heterorhabditis). Por meio do isolamento e da multiplicação em meio caldo triptona de soja (TSB) da bactéria Xenorhabdus szentirmaii (isolado PAM 25), foram realizados testes laboratoriais com tratamentos contendo 10, 25 e 50% do metabólito obtido no sexto dia de cultivo. Para tanto, o metabólito foi centrifugado e filtrado, gerando um sobrenadante, o qual foi diluído em batata + dextrose + ágar (BDA), para verificar as consequências da exposição do fungo L. gongylophorus em placas de Petri. Os tratamentos de controle apenas com meio BDA e misto (BDA + TSB) também foram conduzidos simultaneamente por 14 dias, a fim de confirmar a eficiência dos metabólitos. Tanto na diluição de 25 e 50% houve total inibição do fungo simbionte já nos primeiros dias da condução dos testes. Diante dos resultados obtidos, pode-se afirmar que os metabólitos são a causa do efeito inibitório do desenvolvimento do fungo simbionte das formigas-cortadeiras.

ABSTRACT: Leaf-cutter ants (Hymenoptera: Formicidae) have evolved as dominant herbivores on the American continent. These social insects remove the leaves of economically important plant species to maintain their colony’s food reserves, the symbiotic fungus Leucocoprinus gongylophorus, a basidiomycete. Such fungus can be used for applications of fungicide molecules from metabolites generated by symbiont bacteria (Xenorhabdus and Photorhabdus) from entomopathogenic nematodes (Steinernema and Heterorhabditis). Through isolation and multiplication in tryptic soy broth (TSB) medium of the bacteria Xenorhabdus szentirmaii isolated PAM 25, we conducted laboratorial tests using treatments with 10, 25, and 50% of the metabolites obtained in the sixth day of cultivation. The treatments were centrifuged and filtered to generate a supernatant, which was diluted in potato + dextrose + agar (PDA), to verify the consequences of exposure to the fungus L. gongylophorus in Petri dishes. To confirm metabolite efficiency, the control treatments in PDA only and mixed (PDA+TSB) media were conducted simultaneously for 14 days. We observed total inhibition of the symbiont fungus in both the 25 and 50% dilutions during the first days of the tests. Our results support that these metabolites have inhibitory effect on the development of symbiont fungus of leaf-cutter ants.

RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.

ABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques.

Resumo: O objetivo deste trabalho foi avaliar, in vitro e in vivo, o potencial de isolados de Trichoderma spp.no controle de Sclerotinia sclerotiorum em soja (Glycine max) e identificar molecularmente as estirpes que mais se destacaram. O efeito de 120 isolados de Trichoderma spp. sobre a viabilidade de escleródios de S. sclerotiorum foi avaliado in vitro, por imersão em suspensão de conídios dos antagonistas e plaqueamento em meio de cultura. As estirpes que mais se destacaram foram avaliadas, in vivo, em casa de vegetação, no controle do patógeno em plantas e sementes de soja 'Pintado'. Dos 120 isolados testados in vitro, 22 inibiram em 100% a germinação de escleródios. Em casa de vegetação, cinco estirpes inibiram os efeitos prejudiciais do patógeno na germinação das sementes e duas estirpes proporcionaram aumento de até 67% na massa de matéria seca das plantas. As melhores estirpes foram identificadas como T. koningiopsis (3 estirpes), T. asperelloides (3), T. atroviride (2) e T. virens (1). Trichoderma spp. conseguem proteger plantas de soja 'Pintado' do efeito prejudicial de S. sclerotiorum ao mesmo tempo em que podem promover o crescimento da parte aérea em condições de casa de vegetação.

Abstract: The objective of this work was to evaluate, in vitro and in vivo, the potential of Trichoderma spp. strains to control Sclerotinia sclerotiorum in soybeans (Glycine max) and to perform the molecular identification of the best perfoming strains. The effect of 120 strains of Trichoderma spp. on the viability of S. sclerotiorum sclerotia was evaluated in vitro through immersion in suspension of conidia from the antagonists and plating in culture medium. The best performing strains were evaluated in vivo, in a greenhouse, for control of the pathogen inoculated on 'Pintado' soybean seeds and plants. Of the 120 strains tested in vitro, 22 strains of Trichoderma spp. caused 100% inhibition of sclerotia germination. In the greenhouse, five strains inhibited the negative effect of the pathogen on seed germination and two strains increased in up to 67% plant dry matter. The best performing strains were identified as T. koningiopsis (3 strains), T. asperelloides (3), T. atroviride (2), and T. virens (1). Trichoderma strains are able to protect soybean plants from the harmful effect of S. sclerotiorum and, at the same time, they can promote the growth of the aerial part in greenhouse conditions.

RESUMO A doença de Petri causada, principalmente, por Phaeomoniella chlamydospora e espécies de Phaeoacremonium é grave, complexa, ataca plantas jovens de videira e é de difícil controle no mundo. No Brasil, o estado de São Paulo está entre os maiores produtores da uva ‘Niagara Rosada’ e não há relato oficial desta doença no estado. Assim, os objetivos do presente trabalho foram avaliar a incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo e comparar metodologias para isolar os agentes causais da doença. O delineamento foi inteiramente casualizado, testando-se três meios de isolamento [ágar-água (AA), batata dextrose ágar (BDA) e isca de maçã-verde], com amostras de plantas doentes desinfestadas ou não, nove localidades de coleta e oito repetições (placa de Petri com os meios e quatro fragmentos das plantas por amostra). Anotou-se o número de colônias dos agentes causais por fragmento por placa de cada meio de cultura por localidade. Identificaram-se os isolados dos fungos obtidos por extração de DNA e sequenciamento da região ITS-5.8S do rDNA [ITS1 TCCGTAGGTGAACCTGCGG e ITS4 TCCTCCGCTTATTGATATGC] e partes dos genes da alfa elongase [EF1 ATGGGTAAGGARGACAAGAC e EF2 GGARGTACCAGTSATCATGTT] e da beta tubulina [Bt2a GGTAACCAAATCGGTGCTGCTTTC e Bt2b ACCCTCAGTGTAGTGACCCTTGGC]. Teste de patogenicidade foi feito com um isolado de Phaeomoniella spp. e um de Phaeoacremonium spp. A incidência e a severidade da doença (comprimento das estrias escuras no sistema vascular) foram avaliadas. Os municípios de Louveira B, Vinhedo, Jundiaí, Jarinú, Porto Feliz, São Miguel Arcanjo e Jales foram os que apresentaram a presença dos agentes causais da doença, demonstrando ocorrência da doença de Petri em todo o estado de São Paulo. A espécie de Phaeoacremonium prevalente foi P. minimum (= P. aleophilum). Somente na cidade de Jales, além de P. minimum detectou-se, também, a espécie P. venezuelense. Phaeomoniella chlamydospora foi a única espécie identificada neste gênero. A porcentagem de isolamento foi maior para P. chlamydospora do que para Phaeoacremonium spp. O isolamento dos agentes causais da doença deve ser feito retirando fragmentos do sistema vascular da região do colo das plantas sintomáticas seguido de desinfestação superficial e plaqueamento de fragmentos em meio de cultura BDA. Incuba-se em BOD, a 23ºC, por até 21 dias. O método de isca e depois repicagem para BDA não permitiu isolar nenhum dos agentes causais da doença. Todas as plantas inoculadas desenvolveram sintomas externos e internamente a média do comprimento das estrias escuras para P. chlamydospora foi de 7,9 cm e de P. minimum foi de 5,2 cm. As plantas controle (testemunha) permaneceram sadias. Os fungos foram re-isolados das plantas doentes, completando os postulados de Koch e oficializando a doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil.

ABSTRACT The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.

RESUMO: Bacillus tem sido amplamente estudado e usado para o controle de pragas e doenças. O protocolo adaptado proposto por POLANCZYK (2004) mostrou-se mais eficiente do que o da Organização Mundial de Saúde (WHO, 1985) para isolar cepas edáficas de Bacillus. No entanto, não foi avaliado quanto ao isolamento de estirpes endofíticas, que são muito menos abundantes na natureza e mais difíceis de isolar. Este estudo teve como objetivos comparar dois procedimentos metodológicos para o isolamento de Bacillus, o estabelecido pela OMS (WHO, 1985) e o de POLANCZYK (2004), quanto a sua eficiência para o isolamento de estirpes endofitas e edáficas de Bacillus originárias do interior do tecido radicular de cana-de-açúcar, bem como de amostras de solos associados, coletada de 11 locais; e comparar a densidade de bactérias em ambos os ambientes. As cepas endofíticas e edáficas de Bacillus foram isoladas por ambos os procedimentos. No entanto, o protocolo de isolamento realizado por POLANCZYK (2004) demonstrou-se mais eficiente por gerar maior número de unidades de formação de colônias (CFU) por grama de solo e raiz, indicando que esse procedimento é mais útil, especialmente para isolamento de estirpes endofíticas de Bacillus, que são muito menos abundantes na natureza do que as cepas edáficas, sendo, portanto, mais difíceis de serem isoladas. Usando o protocolo de POLANCZYK (2004), as cepas de Bacillus foram isoladas de todas as amostras de raízes (endofíticas) e de solo (edáficas) de todos os 11 campos, sugerindo que a raiz da planta pode ser outra fonte importante de isolamento de Bacillus além do solo. As densidades mais altas de Bacillus foram isoladas do ambiente edáfico em comparação com o ambiente endofítico, com diferenças significativas quando isoladas pelo método de POLANCZYK (2004).

ABSTRACT: Bacillus has been widely studied and used for the control of pests and diseases. The adapted protocol proposed by POLANCZYK (2004) proved to be more efficient than the one by the World Health Organization (WHO, 1985) to isolate edaphic strains of Bacillus. However, it has not been assessed for isolation of endophytic strains, which are much less abundant in the nature and more difficult to be isolated. This study aimed to compare two methodological procedures for isolation of Bacillus, established by the WHO (1985) and by POLANCZYK (2004), regarding their efficiency for isolation of endophytics and edaphics Bacillus strains from inside the root tissue of sugarcane, as well as from the associated soil sample, collected from 11 locations; and to compare the density of bacteria in both environments. Endophytic and edaphic strains of Bacillus were isolated by both procedures. However, the isolation protocol performed by POLANCZYK (2004) made more efficient by having a greater number of colony forming units (CFU) per gram of soil and root indicating that this procedure is more useful, especially for isolation of endophytic strains of Bacillus, which are much less abundant in the nature than edaphic strains, being therefore more difficult to be isolated. Using the Polanczyk protocol (2004), Bacillus strains were recovered from all roots (endophytic) and soil (edaphic) samples of all the 11 fields, suggesting that the plant root may be another important source for isolation of Bacillus besides the soil. Higher densities of Bacillus were isolated from the edaphic environment compared with the endophytic environment, with significant differences when isolated by Polanczyk method (2004).

Los nematodos entomopatógenos (NEPs) son parásitos obligados de insectos, incluyendo al picudo de la caña Sphenophorus levis. Sin embargo, para la aplicación con éxito de NEPs en cultivos de caña en Brasil se debe tener en cuenta que la cosecha mecánica genera una capa de residuos de hojas (mantillo) en el suelo. En este estudio se evaluaron la influencia de la cobertura vegetal sobre la persistencia del nematodo Steinernema brazilense(cepa IBCB n6) en cultivo de caña, usando larvas de Galleria mellonella. S. brazilense puede persistir en el suelo de caña al menos durante 278 días después de su aplicación y el mantillo no afecta su persistencia, pero sí favorece su diseminación en comparación con el suelo desnudo.

Entomopathogenic nematodes (EPN's) were tested for sugarcane soil dwelling pests, including the billbug, Sphenophorus levis. The successful application of EPN's to protect sugarcane crops in Brazil requires the consideration of several aspects, including the widespread use of mechanical harvesting, which discards cane leaves in fields, resulting in a thick layer of mulch covering the ground. In this study, the influence of mulch on the persistence of Steinernema brazilense(strain IBCB n6) in sugarcane fields was examined. Nematode persistence in the soil was evaluated using Galleria mellonella larvae as an attractant. Results showed that S. brazilense can persists in sugarcane fields for at least 278 days after its application, and mulch does not affect its persistence, thus favoring its spread as compared to bare soil.

O bicudo-da-cana-de-açúcar, Sphenophorus levis (Coleoptera: Dryophthoridae), é uma importante praga em canaviais do Estado de São Paulo. Suas larvas destroem o rizoma da planta, causando prejuízos de até 30 t ha-1 ano-1 de cana. Três experimentos de campo foram conduzidos para avaliar a eficácia de nematoides entomopatogênicos e de inseticidas químicos no controle do bicudo-da-cana-de-açúcar e do escarabeídeo Leucothyreus sp. O primeiro consistiu de 10 tratamentos: 1) tiametoxam (Actara 250WG) 500 g ha-1 de produto comercial (p.c.); 2) tiamethoxam 1,0 kg ha-1 p.c.; 3) tiametoxam 1,5 kg ha-1 p.c.; 4) Steinernema brazilense 10(8) juvenis infectivos (JI) ha-1 + tiametoxam 250 g ha-1 p.c.; 5) S. brazilense (10(8) JI ha-1) + tiametoxam 500 g ha-1 p.c.; 6) Heterorhabditis indica (10(8) JI ha-1) + tiametoxam 250 g ha-1 p.c.; 7) H. indica (10(8) JI ha-1) + tiametoxam 500 g ha-1 p.c.; 8) S. brazilense (10(8) JI ha-1); 9) H. indica (10(8) JI ha-1); e 10) Testemunha. No segundo, foram considerados cinco tratamentos: 1) tiametoxam (Actara 250WG) 800 g ha-1 p.c.; 2) fipronil (Regente 800WG) 250 g ha-1 p.c.; 3) S. brazilense (10(8) JI ha-1); 4) S. brazilense (10(8) JI ha-1) + tiametoxam (Actara 250WG) 200 g ha-1 p.c.; e 5) Testemunha. O terceiro incluiu todos os tratamentos do segundo experimento, mais a mistura S. brazilense (10(8) JI ha-1) + fipronil (Regente 800WG) 62,5 g ha-1 p.c. Todos os tratamentos com inseticidas e nematoides proporcionaram maior produção de cana, quando comparados às respectivas testemunhas, que foram mais danificadas por S. levis, mas sem diferenças significativas. O nematoide S. brazilense foi mais eficaz no controle deste inseto, quando comparado com H. indica, mas sem diferenças significativas. S. brazilense proporcionou 50% de controle das larvas de Leucothyreus sp., e os melhores tratamentos para controle deste inseto foram as misturas do nematoide com fipronil (78%) e tiametoxam (83%).

The sugarcane billbug, Sphenophorus levis (Coleoptera: Dryophthoridae), is an important pest of sugarcane crops in the São Paulo State, Brazil. Their larvae damage plants rhizome, causing losses of up to 30 t ha-1 year-1 of sugarcane. In order to evaluate the effectiveness of entomopathogenic nematodes and chemical insecticides against the sugarcane billbug and the scarab beetle Leucothyreus sp., three field trials were carried out in Brazil. For the first one, 10 treatments were considered: 1) thiametoxan (Actara 250WG) 500 g ha-1 of commercial product (c.p.); 2) thiametoxan 1.0 kg ha-1 c.p.; 3) thiametoxan 1.5 kg ha-1 c.p.; 4) Steinernema brazilense 10(8) infective juveniles (IJ) ha-1 + thiametoxan 250 g ha-1 c.p.; 5) S. brazilense (10(8) IJ ha-1) + thiametoxan 500 g ha-1 c.p.; 6) Heterorhabditis indica (10(8) IJ ha-1) + thiametoxan 250 g ha-1 c.p; 7) H. indica (10(8) IJ ha-1) + thiametoxan 500 g ha-1 c.p.; 8) S. brazilense (10(8) IJ ha-1); 9) H. indica (10(8) IJ ha-1); and 10) Control. The second one consisted of five treatments: 1) thiametoxan (Actara 250WG) 800 g ha-1 c.p.; 2) fipronil (Regente 800WG) 250 g ha-1 c.p.; 3) S. brazilense (10(8) IJ ha-1); 4) S. brazilense (10(8) IJ ha-1) + thiametoxan 200 g ha-1 c.p.; and 5) Control. In the third one, all treatments already mentioned for the second trial plus the mixture S. brazilense (10(8) IJ ha-1) + fipronil (Regente 800WG) 62.5 g ha-1 c.p. were considered. All treatments with the insecticides and nematodes provided higher sugarcane yield, when compared to their respective controls, which were most damaged by S. levis, but without statistical significance. S. brazilense was more efficient on controlling this pest, if compared to H. indica, but without statistical significance. S. brazilense provided a 50% control of Leucothyreus sp. larvae, meanwhile the best treatments against this scarab were the mixtures of this nematode with fipronil (78%) and thiametoxan (83%).

O bicudo da cana-de-açúcar, Sphenophorus levis (Coleoptera: Curculionidae), é uma importante praga de solo dos canaviais no Estado de São Paulo, ocasionando prejuízos de até 30 t de cana/ha/ano. Visando ao controle biológico desta praga, esse estudo teve por objetivo avaliar a virulência de 17 isolados de nematóides entomopatogênicos do gênero Steinernema e Heterorhabditis contra adultos de S. levis, e o efeito dos quatro nematóides mais virulentos em três dosagens cada um. A pesquisa foi realizada em condições de laboratório, sendo realizados quatro ensaios para o estudo de virulência. Os nematóides selecionados como mais virulentos em cada teste foram S. brazilense IBCB n6, Heterorhabditis sp. IBCB n10, Heterorhabditis sp. IBCB n24 e Heterorhabditis sp. IBCB n44, sendo os únicos que diferenciaram significativamente das respectivas testemunhas com 45%, 40%, 20% e 31% de mortalidade do inseto na concentração de 240 juvenis infectivos (JI)/inseto. No teste de dose, os isolados de Heterorhabditis identificados como IBCB n10, IBCB n24 e IBCB n44 destacaram-se quanto à virulência para os adultos do bicudo da cana-de-açúcar, diferindo significativamente da testemunha na maior dose avaliada (1200 JI/inseto) com níveis de mortalidade do inseto de 60%, 65,7% e 74,3% respectivamente.

The sugarcane billbug, Sphenophorus levis (Coleoptera: Curculionidae) is an important underground pest of the sugarcane crop in São Paulo state, causing losses up to 30 tons of cane/ha/year. This study aimed to evaluate the virulence of 17 strains of entomopathogenic nematodes on the genus Steinernema and Heterorhabditis against adults of S. levis, and the effect of the four most virulent ones in three dosage each one. The research was done in laboratory conditions, performing four tests related to the virulence study and one related to the dosage study. S. brazilense IBCB n6, Heterorhabditis sp. IBCB n10, Heterorhabditis sp. IBCB n24 and Heterorhabditis sp. IBCB n44 were the most virulent ones, differing significantly from the respective control with 45%, 40%, 20% and 31% mortality of insects using the concentration of 240 infective juveniles (IJ)/insect. For the dosage test, the strains IBCB n10, IBCB n24 and IBCB n44 of Heterorhabditis noteworthy concerning the virulence for adults of the sugarcane billbug, differing significantly from the control at the higher dosage (1200 IJ/insect) with insect mortality levels of 60%, 65,7% e 74,3%, respectively.