Resumo Fundamentos: Poucos estudos utilizaram analisadores de gases portáteis no teste da caminhada de seis minutos (T6m) em portadores de insuficiência cardíaca com fração de ejeção normal (ICFEN). Objetivos: Analisar a cinética das variáveis hemodinâmicas, ventilatórias e metabólicas utilizando analisador de gases portátil em portadores de ICFEN durante o T6m. Métodos: Estudo prospectivo, analítico, com amostra não probabilística, intencional e por conveniência. Foram estudados 24 pacientes portadores de ICFEN com passado de internação por clínica de insuficiência cardíaca (IC), incluídos pelos critérios da European Society of Cardiology 2007. Realizaram-se três avaliações: T6m de aprendizado, T6m com o analisador de gases portátil e teste de esforço cardiopulmonar (TECP). Resultados: As frequências cardíacas (FC) e o consumo de oxigênio (VO2) pico ao final do T6m corresponderam a 85,7% e 86,45% dos valores obtidos no TECP. As FC finais no T6m foram equivalentes às obtidas no limiar anaeróbio (LA) do TECP, com valores de VO2 relativo ao final do T6m acima do VO2 no LA do TECP. Não houve diferença entre os valores máximos do quociente respiratório (QR) entre os dois testes, ambos acima de 1,0. A curva de VE/VO2 demonstrou descenso com posterior ascensão significativa após o quinto minuto de teste, estimando-se a identificação do LA. Conclusões: Para pacientes com ICFEN, o T6m representa um esforço quase máximo, sendo executado acima do LA do TECP e acima dos 85% da FC máxima e do VO2 pico do TECP, com QR máximo semelhante ao do TECP.

Abstract Background: Few studies have used portable gas analyzers during the 6-minute walk test (6MWT) in patients with heart failure and normal ejection fraction (HFNEF). Objectives: To analyze the kinetics of hemodynamic, ventilatory, and metabolic variables in patients with HFNEF during the T6m using a portable gas analyzer. Methods: Prospective, analytical study with an intentional, non-probabilistic, convenience sample. In total, 24 patients with HFNEF and past hospital admissions due to a clinical diagnosis of heart failure (HF) were included using the 2007 criteria established by the European Society of Cardiology. Three assessments were performed: 6MWT familiarization, 6MWT with the portable gas analyzer, and cardiopulmonary exercise test (CPET). Results: The heart rates (HRs) and the peak VO2 at the end of the 6MWT corresponded to 85.7% and 86.45% of the values obtained during the CPET. The final HRs after the T6m were equivalent to those obtained at the CPET anaerobic threshold (AT), with relative VO2 values at the end of the 6MWT above the VO2 of the CPET AT. There was no difference between the maximum respiratory quotient (RQ) values in these two tests, which were both above 1.0. The VE/VO2 slope descended initially and then ascended significantly after the fifth minute of the test, estimating the identification of the AT. Conclusions: In patients with HFNEF, the 6MWT represents an almost maximum effort, and is performed above the CPET AT and 85% above the maximum HR and the CPET peak VO2, with a maximum RQ similar to that in the CPET.

Resumo Objetivou-se investigar o efeito de 12 semanas de treinamento aeróbio e resistido na capacidade cardiorrespiratória máxima e submáxima de jovens com Síndrome de Down (SD). Quarenta e um indivíduos de ambos os gêneros com Síndrome de Down (idade, 15,51±2.70 anos) foram divididos em três grupos: GC (grupo controle) com 10 participantes; GTA (grupo treino aeróbio) com 16 participantes; e GTR (grupo treino resistido) com 15 participantes. O programa de treinamento teve duração de 12 semanas, com frequência de 3 dias por semana para o GTA e duas para o GTR, com duração de 50 minutos por sessão. O treino aeróbio era realizado na esteira/ bicicleta ergométrica com intensidade entre 50 e 70% da frequência de reserva, enquanto o treino resistido era composto de nove exercícios que eram realizados em três series de 12 repetições para cada exercício. O treino aeróbio e resistido não foram capazes de aumentar o consumo máximo de oxigênio. Entretanto, houve um aumento na ventilação máxima e diminuição na frequência cardíaca submáxima para os dois grupos que participaram dos programas de treinamento. Além disso, o GTA aumentou a capacidade de trabalho. Os programas de treinamento promoveram uma melhora na eficiência cardíaca durante atividades submáximas e aumento na ventilação máxima, o que demostra uma melhora na capacidade cardiorrespiratória.

Abstract The aim of this study was to investigate the effects of 12 weeks of aerobic and resistance training on the maximal and submaximal cardiorespiratory fitness of young people with Down Syndrome (DS). Forty-one individuals of both sexes with Down syndrome (age, 15.51±2.70 y) were divided into three groups: CG (control group) with 10 participants; ATG group (aerobic training group) with 16 participants; and RTG (resistance training group) with 15 participants. The training program lasted 12 weeks, with frequency of 3 days a week for ATG and two RTG, and duration of 50 minutes per session. Aerobic training consisted of exercise on a treadmill/bike at intensity between 50 and 70% of reserve heart rate, while resistance training was composed of nine exercises performed on three sets of 12 maximum repetitions for each exercise. Aerobic and resistance training were not able to increase peak oxygen uptake. However, there was an increase in the maximum ventilation and a decrease of submaximal heart rate only for groups who participated in the training program. Moreover, the aerobic group increased work capacity after training. Training programs led to an improvement in cardiac efficiency during submaximal activities and increased maximum ventilation, which demonstrates a cardiorespiratory improvement

INTRODUÇÃO: O teste de esforço cardiopulmonar (TECP) fornece dados que orientam tratamento, prognóstico e tomadas de decisões. Entretanto, seu uso na insuficiência cardíaca de fração de ejeção normal (ICFEN) ainda não está bem esclarecido, em especial considerando novas variáveis que vêm despontando. OBJETIVOS: Comparar o comportamento das principais variáveis diagnósticas e prognósticas do TECP entre dois grupos: pacientes com insuficiência cardíaca de fração de ejeção reduzida (ICFER) e pacientes com ICFEN. MÉTODOS: Foram avaliados 36 pacientes com insuficiência cardíaca em classe funcional II-III da NYAH: 20 com ICFEN e 16 com ICFER do ambulatório de insuficiência cardíaca do Hospital Universitário Antônio Pedro (UFF). Os pacientes do Grupo ICFER selecionados foram os com FE < 35% e os do grupo ICFEN seguiram os critérios diagnósticos da Sociedade Europeia de Cardiologia de 2007. Realizou-se TECP, em esteira com protocolo de rampa, com analisador de gases VO2000. Foram aplicados teste t de Student, Mann-Whitney, teste de Fisher, modelo linear generalizado e de Cochran-Mantel-Haenszel para as análises estatísticas. RESULTADOS: O grupo ICFEN apresentou níveis mais elevados da pressão arterial em repouso, na resposta ao esforço, na potência circulatória e ventilatória, além de um maior tempo de recuperação da cinética do consumo de oxigênio. Não houve diferença em relação a outras variáveis prognósticas do TECP para o grupo ICFER. CONCLUSÕES: A pressão arterial de repouso e em esforço, a potência circulatória e ventilatória e a cinética de recuperação do VO2 (T1/2) foram as variáveis que apresentaram maior valor discriminativo entre os grupos pelo TECP.

INTRODUCTION: The cardiopulmonary exercise testing (CPX) provides data that guide treatment, prognosis and decision making. However its use in heart failure with normal ejection fraction (HFnEF) is still not all clear, especially considering new variables that are emerging. OBJECTIVE: To compare the behavior of key diagnostic and prognostic variables of CPX testing between two groups; patients with heart with reduced ejection fraction of (HfrEF) and those with HFnEF). METHODS: 36 patients with heart failure were evaluated in Nyah functional class II-III: 20 with HFnEF and 16 patients with HFrEF at the Hospital Universitário Antônio Pedro (UFF). The patients from HFrEF group were those with EF<35%, and those from the HFnEF group follow the diagnostic criteria of the European Society of Cardiology 2007. CPX was performed on a treadmill with a ramp protocol, with gas analyzer VO2000. The Student t test, Mann-Whitney test and Fisher, generalized linear model and the Cochran-Mantel-Haenszel test for statistical analysis were applied. RESULTS: The HFnEF group presented higher levels of blood pressure at rest, higher response to exertion, higher circulatory and ventilatory power, and longer recovery kinetics of oxygen uptake. There was no difference in relation to other prognostic variables of CPX in the HFrEF group. CONCLUSIONS: The blood pressure at rest and during exercise, the circulatory and ventilatory capacity and the kinetics of VO2 (T1/2), were the variables that showed the highest discriminative value between the two populations by CPX.

INTRODUCCIÓN: La prueba de esfuerzo cardiopulmonar (PECP) suministra datos que orientan tratamiento, pronóstico y tomas de decisiones. No obstante, su uso en la insuficiencia cardíaca de fracción de eyección normal (ICFEN) todavía no está bien aclarado, en especial, considerando nuevas variables que vienen apareciendo. OBJETIVOS: Comparar el comportamiento de las variables principales de diagnóstico y de pronóstico de la PECP, entre dos grupos: pacientes con insuficiencia cardíaca de fracción de eyección reducida (ICFER) y pacientes con ICFEN. MÉTODOS: Se evaluaron 36 pacientes con insuficiencia cardíaca en clase funcional II-III de la NYAH: 20 con ICFEN y 16 con ICFER del dispensario de insuficiencia cardíaca del Hospital Universitário Antonio Pedro (UFF). Los pacientes del grupo ICFER fueron seleccionados con FE <35% y el grupo ICFEN siguieron los diagnósticos de la Sociedad Europea de Cardiología 2007 criterios. Se realizó la PECP, en estera con regulador de rampa, con analizador de gases VO2000. Se aplicaron las pruebas t de Student, Mann-Whitney, prueba de Fisher, modelo linear generalizado y de Cochran-Mantel-Haenszel para los análisis estadísticos. RESULTADOS: El grupo ICFEN presentó niveles más altos de presión arterial en reposo, en la respuesta al esfuerzo, en las potencias circulatoria y ventilatoria, además de un tempo más prolongado de recuperación de la cinética del consumo de oxígeno. No hubo diferencia en relación con otras variables de pronóstico de la PECP para el grupo ICFER. CONCLUSIONES: La presión arterial de reposo y en esfuerzo, las potencias circulatoria y ventilatoria y la cinética de recuperación del VO2 (T1/2) fueron las variables que presentaron más valor discriminativo entre los grupos según la PECP.

A Clorose Variegada dos Citros (CVC) é uma doença economicamente importante e destrutiva no Brasil e é causada pela bactéria Xylella fastidiosa e transmitida por insetos vetores tal como Oncometopia facialis. Nesse estudo, a eficácia do fungo Metarhizium anisopliae em controlar o inseto vetor O. facialis foi estudada em condições de bioensaio. Nesse bioensaio, insetos foram pulverizados com uma suspensão de 5 X 10(7) conídio mL-1. Insetos-adultos capturados no campo foram tratados em grupos de 10, em um total de 11 replicatas por tratamento. Diferenças significativas entre a mortalidade natural e a mortalidade dos insetos tratados com o fungo foram observadas em 6 dias após a inoculação (P<0.05). Estas diferenças significativas aumentaram antes do décimo dia após o tratamento. O fungo causou uma mortalidade de 87,1%, com uma LT50 variando entre 5 e 6 dias. A LC50 foi de 1,2 X 10(6) conídio mL-1, variando de 7,7 X 10(5) a 2 X 10(6) conídio mL-1. Estes resultados mostraram que o vetor O. facialis foi susceptível a ação entomopatogênica de M. anisopliae em condições controladas durante o bioensaio.

Citrus Variegated Chlorosis (CVC) is an economically important, destructive disease in Brazil and is caused by Xylella fastidiosa and transmitted by sharpshooter insects. In this study, the efficacy of the fungus Metarhizium anisopliae in controlling the sharpshooter Oncometopia facialis was studied by bioassay conditions. In the bioassay, insects were sprayed with a suspension containing 5 X 10(7) conidia mL-1. Adults captured in the field were treated in groups of 10 in a total of 11 replications per treatment. Significant differences between the natural mortality and the mortality of insects treated with the fungus were observed 6 days after inoculations (P<0.05). These significant differences increased until 10 days after treatment. The fungus caused 87.1% mortality, with the LT50 varying from 5 to 6 days. The LC50 was 1.2 X 10(6) conidia mL-1, varying from 7.7 X 10(5) to 2 X 10(6) conidia mL-1. The results showed that the sharpshooter O. facialis was susceptible to the entomopathogenic action of M. anisopliae in controlled condition during bioassay.

O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales) linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae), contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS) e não autoclavado (NAS) de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10) para AS e 2,52 x 10(10) para NAS. A concentração letal (LC50) expressa pela concentração de conídios, foi 8,44 x 10(9) conídios/g de solo para AS e 12,2 x 10(9) conídios/g/S para NAS.

The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales) strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae), against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS) and non-autoclaved (NAS) soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10) for AS and 2.52 x 10(10) for NAS. The lethal concentration (LC50), expressed as conidia concentration, was 8.44 x 10(9) conidia/g of soil (S) for AS and 12.23 x 10(9) conidia/g of soil for NAS.

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

Este trabalho objetivou determinar a CL50 de um peptídeo produzido pelo fungo N. rileyi, para larvas de 3º ínstar de A. gemmatalis. O peptídeo foi produzido através de fermentação aerada, em meio SMY, sob condições controladas por 12 dias. O metabólito foi purificado, utilizando-se de sistemas de cromatografia. Os cristais obtidos foram então armazenados a baixa temperatura para posterior análise da atividade biológica. Os experimentos foram conduzidos em 3 repetições, com tratamentos que consistiram de soluções com 0,0001; 0,001; 0,01; 0,1; 0,2 e 1,0 mg/mL. Através de análise de regressão chegou-se a equação da reta Y = 6,81176 + 1,01382 * LOGx e um valor para CL50 de 0,0163 mg/mL.

The entomopathogenic fungus Nomuraea rileyi (Farlow) Samson produced a peptide active against Anticarsia gemmatalis 3rd instar larvae. To produce this peptide, N. rileyi was cultivated aerobically in Saboraud, maltose, yeast-extract broth at 26 ± 1ºC for 12 days, after which the medium was filtered and separated in a liquid/liquid extractor, concentrated and the peptide purified chromatographically. The crystals obtained were kept refrigerated until needed for LC50 analysis. The LC50 of this peptide against A. gemmatalis 3rd instar larvae was determined in triplicate experiments using solutions containing 1.0, 0.2, 0.1, 0.01, 0.001 and 0.0001 mg/ml of N. rileyi peptide. The results of these experiments were used to calculate a linear equation in which Y = 6,81176 + 1,01382 * LOGx , giving a LC50 value of 0.0163 mg/ml.

Dois estágios de desenvolvimento a saber: conídio (C) e micélio (M) em 10 linhagens de Metarhizium anisopliae var. anisopliae e 2 M. anisopliae var. majus, foram estudados em dois diferentes meios de cultivos, minimo (MM) e completo (MC). As linhagens apresentaram-se similares quanto a porcentagem de lipídios totais, porém submetidas ao teste de Tukey, as médias dos conteúdos de lipídios do conídio (C) e do micélio (M) cultivados em meio MM e CM respectivamente, mostraram diferença significativa ao nível de 5% , indicando assim variabilidade para a produção de lipídios totais. As linhagens 5 e 7, ambas da var. majus, não apresentam diferenças mensuráveis da variedade anisopliae. Com os ácidos graxos C18:1 e C18:2 oléico e linoléico respectivamente, as diferenças foram todas altamente significativas (p= 1%) com a mais alta média de C18:1 para conídio e C18:2 para micélio.

Two growth stages, conidia (C) and mycelium (M), and two media, minimal medium (MM) and complete medium (MC), were compared in 10 strains of M. anisopliae, and two strains of M. anisopliae var. majus were similar in percentages of total lipids. Tukey test for average of lipid content in conidia (C) and mycelia (M) cultured on minimal (MM) and complete (MC) media showed significant differences between means at the 5% level for mycelia and conidia, indicating variability in total lipid production and storage during growth. Strains 5 and 7, both variety majus, did not present sizable differences from variety anisopliae. For fatty acids, C18:1 and C18:2, oleic and linoleic, respectively, the differences were all highly significant (p= 1%) with the highest means being obtained for conidia for fatty acid C18:1 and for myclelia for fatty acid C18:2.

É apresentado um exemplar de atrofia hemifacial progressiva com acometimento característico da hemiface direita. Concomitantemente, havia crises epilépticas dimidiadas à esquerda. O EEG mostrou depressão do ritmo à esquerda e lentificação à direita. Na TC havia atrofia à esquerda e hipercaptação frontal direita do contraste. O EMG mostrou lentificação na condução nervosa facial à direita. Comentários são feitos sobre os achados acima, bem como uma revisão da literatura.

A caracteristic case of hemifacial progressive atrophy at right is reported. The patient was a man with 45 year-old. There were epileptic crisis at left too. Alterations observed in clinical-neurological examination are referred. In computadorized tomographic axial examination there were parietotemporal atrophy at left and frontal contrast hipercaptation at right. In EEG there were lentification at right and depression at left who was in concordance with the pathological alterations of the patient: atrophy and cortical depression at left with facial atrophy at right and lentification and contrast hipercaptation at right with epileptic crisis at left. EMG showed facial velocity condution slowed at right. The authors believe in atrophy hemifacial progressive has been a disease which injuries central and peripheral nervous system at one time.