ABSTRACT The obstacles in Phakopsora pachyrhizi management result especially from susceptible soybean genotypes and resistant fungal strains. The objective of the current study was to evaluate the applicability of the emission of extremely low and specific frequencies by Effatha technology in the soybean Asian rust control, nutrition, and its impact on yield. The in-vivo test followed the detached leaves method, with six treatments: frequencies 1 and 2 individually and in association; the conventional chemical treatment (fungicide azoxystrobin + benzovindiflupyr); and witnesses in presence and absence of the fungus. Frequency 1 relates to inhibition of the enzyme succinate dehydrogenase and 2 to ubiquinone oxidase. In the field, frequencies 1 and 2 associated (with the same fungicidal action of the in-vivo study); nutritional frequency; application of azoxystrobin + benzovindiflupyr + mancozeb, and control without application were evaluated. In vivo, the fungicide provided 85% control of the disease symptoms, against 65% of frequencies 1 and 2 in association, which showed a higher efficiency compared to the isolated frequencies. In the field, the rate of increase of symptoms were reduced by all treatments compared to the control. At the end of the soybean cycle, the conventional fungicide resulted in 33% severity against 56% of frequencies 1 and 2 associated, and 69.2% of the control. The emission of the frequency for increased nutrient efficiency stood out positively on yield in relation to all the other ones. The conventional application provided the highest weight of 1,000 grains, possibly a direct reflection of the better control of the disease.

ABSTRACT Petri disease is a problem for vineyard caused mainly by the fungus Phaeomoniella chlamydospora. Contaminated seedlings are source of inoculum for the disease. Treatment to disinfect vine rootstock cuttings for seedling production is hot water treatment (HWT) by 50 °C for 30 min, but the efficiency is contested. To improve its efficacy, the study aimed to assess the combination of the following methods and the reason for the control: i) exposition of the fungus to five different temperatures in HWT bath for 30 min; ii and iii) exposition of the fungus and also plants infected with P. chlamydospora to different disinfection treatments (biofumigation = soil + cabbage at 40 °C; temperatures of 40 and 23 °C, all in microcosm), in different periods (7, 14 and 21 days), with and without additional HWT (51 °C for 30 min). The results showed that HWT with high temperatures (55–70 °C) for 30 min inactivated the fungus. Biofumigation technique at 40 °C and the temperature solely of 40 °C applied for up to 21 days and combined with HWT (51 °C for 30 min) inhibited mycelial growth and inactivated the fungus in vine plant tissues without compromising the rooting.

Abstract This study aimed to evaluate the resistance of three common bean genotypes (BRS Estilo, A211 and Mortiño) to the Fusarium oxysporum f. sp. phaseoli using different inoculation methods such as the root-dip, the colonized toothpick, and the agar-based disk-diffusion. After 35 days of inoculation, the disease severity was assessed by vascular discoloration on the stem of the plants by two methods: using a scoring scale and measuring the length of the discoloration with the aid of a millimeter ruler (cm). Results showed that the root-dip was the most effective inoculation method. As for the method of assessing the disease severity, the scoring scale was the best one, in addition to being easier for evaluating large amounts of common bean lines.

RESUMO: As enzimas extracelulares estão envolvidas na patogênese de fungos em plantas. Atualmente, não há uma padronização de meios de cultura, formas de analisar e divulgar os dados de enzimas extracelulares produzidas em condições in vitro. Assim, o presente trabalho objetivou comparar os meios de cultura específicos relatados na literatura (normal) com o meio de batata-dextrose-ágar mais adição do substrato específico para produção de enzimas extracelulares por três diferentes fungos fitopatogênicos habitantes de solo (Fusarium solani f. sp. passiflorae, Sclerotium rolfsii e Rhizoctonia solani AG-4 HGI), bem como avaliar os dados das enzimas por cinco critérios diferentes. O delineamento experimental adotado foi o inteiramente ao acaso, em esquema de três fatores (meios, isolados e enzimas), com seis repetições. As enzimas investigadas foram amilase, carboximetilcelulase, lipase, lacase, catalase e gelatinase. Os meios normais detectaram mais enzimas, e essa detecção foi mais precisa em comparação com os meios de batata-dextrose-ágar mais o substrato específico. Os critérios que calcularam a área da coroa circular para as enzimas amilase, carboximetilcelulase, lipase e lacase e adotaram a escala de notas para medir a intensidade (0=ausência até 4=intensa) de catalase e gelatinase foram os melhores para avaliar e divulgar os resultados das enzimas. Assim, sugere-se padronizar os meios normais para estudos de produção de enzimas, bem como os critérios citados para avaliar e divulgar os dados das atividades das referidas enzimas.

ABSTRACT: Extracellular enzymes are involved in the fungal pathogenesis in plants. Currently, culture media, data analyses, and data report related to extracellular enzymes produced in vitro conditions are different and therefore, lack standardization. This work aimed to compare the culture media cited on the literature (normal) with the potato-dextrose-agar (PDA) medium combined with a specific compound to produce extracellular enzymes through three soilborne phytopathogenic fungi (F. solani f. sp. passiflorae, S. rolfsii, and R. solani AG-4 HGI), as well as to analyze and report enzyme data based on five different criteria. The assay was randomized, with three factors (culture media, isolates, and enzymes) and six repetitions. The studied enzymes were amylase (AM), carboxymethylcellulase (CMCase), lipase (LP), laccase (LC), catalase (CT), and gelatinase (GT). The normal media detected more enzymes and was more precise compared to the PDA medium plus specific compound. The criteria that calculated the area of the circular crown of AM, CMCase, LP, and LC and measured the intensity (0 = absence, up to 4 = intense) of CT and GT adopting note scale were the best to evaluate and report the results of the enzymes. We suggest the normal media culture to study enzyme production, as well as the criteria mentioned to assess and report the data related to enzyme activities.

RESUMO A doença de Petri causada, principalmente, por Phaeomoniella chlamydospora e espécies de Phaeoacremonium é grave, complexa, ataca plantas jovens de videira e é de difícil controle no mundo. No Brasil, o estado de São Paulo está entre os maiores produtores da uva ‘Niagara Rosada’ e não há relato oficial desta doença no estado. Assim, os objetivos do presente trabalho foram avaliar a incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo e comparar metodologias para isolar os agentes causais da doença. O delineamento foi inteiramente casualizado, testando-se três meios de isolamento [ágar-água (AA), batata dextrose ágar (BDA) e isca de maçã-verde], com amostras de plantas doentes desinfestadas ou não, nove localidades de coleta e oito repetições (placa de Petri com os meios e quatro fragmentos das plantas por amostra). Anotou-se o número de colônias dos agentes causais por fragmento por placa de cada meio de cultura por localidade. Identificaram-se os isolados dos fungos obtidos por extração de DNA e sequenciamento da região ITS-5.8S do rDNA [ITS1 TCCGTAGGTGAACCTGCGG e ITS4 TCCTCCGCTTATTGATATGC] e partes dos genes da alfa elongase [EF1 ATGGGTAAGGARGACAAGAC e EF2 GGARGTACCAGTSATCATGTT] e da beta tubulina [Bt2a GGTAACCAAATCGGTGCTGCTTTC e Bt2b ACCCTCAGTGTAGTGACCCTTGGC]. Teste de patogenicidade foi feito com um isolado de Phaeomoniella spp. e um de Phaeoacremonium spp. A incidência e a severidade da doença (comprimento das estrias escuras no sistema vascular) foram avaliadas. Os municípios de Louveira B, Vinhedo, Jundiaí, Jarinú, Porto Feliz, São Miguel Arcanjo e Jales foram os que apresentaram a presença dos agentes causais da doença, demonstrando ocorrência da doença de Petri em todo o estado de São Paulo. A espécie de Phaeoacremonium prevalente foi P. minimum (= P. aleophilum). Somente na cidade de Jales, além de P. minimum detectou-se, também, a espécie P. venezuelense. Phaeomoniella chlamydospora foi a única espécie identificada neste gênero. A porcentagem de isolamento foi maior para P. chlamydospora do que para Phaeoacremonium spp. O isolamento dos agentes causais da doença deve ser feito retirando fragmentos do sistema vascular da região do colo das plantas sintomáticas seguido de desinfestação superficial e plaqueamento de fragmentos em meio de cultura BDA. Incuba-se em BOD, a 23ºC, por até 21 dias. O método de isca e depois repicagem para BDA não permitiu isolar nenhum dos agentes causais da doença. Todas as plantas inoculadas desenvolveram sintomas externos e internamente a média do comprimento das estrias escuras para P. chlamydospora foi de 7,9 cm e de P. minimum foi de 5,2 cm. As plantas controle (testemunha) permaneceram sadias. Os fungos foram re-isolados das plantas doentes, completando os postulados de Koch e oficializando a doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil.

ABSTRACT The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.

RESUMO O fungo Cylindrocladium spathiphylli causa podridão no colo e nas raízes de espatifilo. Fungos produzem enzimas extracelulares e muitas destas podem estar envolvidas na patogênese. Há poucos estudos procurando comprovar o papel de uma determinada enzima na patogênese, principalmente no patossistema C. spathiphylli e espatifilo. Assim, o objetivo do presente trabalho foi verificar a patogenicidade de diferentes isolados do fungo em espatifilo, em condições de BOD, e depois relacionar a patogênese com a produção in vitro da enzima extracelular lacase. O ensaio da patogenicidade foi inteiramente casualizado, com dois isolados normais e três isolados alterados por fungistase com seis repetições. Após a inoculação, avaliou-se a severidade da doença em mudas de espatifilo em quatro períodos (até 10 dias) com uma escala de notas (1,0 – sadia até 3,0 – morte de plantas). Aos 10 dias de avaliação, a severidade média da doença causada pelo isolado normal MMBF 01/01 e pelos isolados alterados MMBF 01/01 – 9 D e LFEEI016 – 3 D foi semelhante, enquanto que a severidade causada pelo isolado normal LFEEI016 não diferiu da testemunha. O isolado alterado MMBF 01/01 – 3 D apresentou severidade máxima da doença (nota média 3,0) aos sete dias de avaliação, diferindo dos demais. Quanto à enzima lacase, delineou-se ensaio inteiramente casualizado, com os mesmos isolados do fungo, em placa de Petri contendo meio específico para produção da enzima lacase com seis repetições. Mensurou-se a área da coroa circular da enzima formada no meio. A maior área média da enzima foi produzida pelo isolado alterado MMBF 01/01 – 3 D (2256,0 mm2), enquanto que as áreas dos isolados alterados LFEEI016 – 3 D e MMBF 01/01 – 9 D e do isolado normal MMBF 01/01 foram iguais e a menor área de lacase foi produzida pelo isolado normal LFEEI016 (747,2 mm2). Há uma relação quanto à quantidade da enzima lacase produzida in vitro com a severidade da doença causada pelos isolados na planta, o que reforça a necessidade de mais estudos in vivo para provar o papel da lacase na patogênese do fungo C. spathiphylli em espatifilo.

ABSTRACT The fungus Cylindrocladium spathiphylli causes collar and root rot in spathiphyllum. Fungi produce extracellular enzymes, most of which can be involved in pathogenicity. There are few studies that aim to prove the role of a certain enzyme in pathogenicity, especially for the pathosystem C. spathiphylli and spathiphyllum. Thus, the aim of the present study was to verify, under BOD conditions, the pathogenicity of different fungal isolates in spathiphyllum and to relate such pathogenicity to the in vitro production of the extracellular enzyme laccase. The pathogenicity assay was completely randomized with two normal isolates and three isolates altered by fungistasis, in six replicates. After inoculation, disease severity in spathiphyllum seedlings was evaluated at four different periods (until 10 days), using a score scale (1.0=health to 3.0=death of seedling). At 10 days, mean disease severity caused by the normal isolate MMBF 01/01 was similar to that caused by the altered isolates MMBF 01/01 – 9 D and LFEEI016 – 3 D, while the disease severity caused by the normal isolate LFEEI016 did not differ from that of control. The altered isolate MMBF 01/01 – 3 D showed maximum disease severity (average score 3.0) at seven days of evaluation, differing from the remaining isolates. As to the enzyme laccase, a completely randomized assay was designed with the same fungal isolates on Petri plate containing specific medium for laccase production, in six replicates. The area of the circular crown formed in the medium was measured. The largest mean area of the enzyme was produced by the altered isolate MMBF 01/01 – 3 D (2256.0 mm2), while the areas produced by the altered isolates LFEEI016 – 3 D and MMBF 01/01 – 9 D were equal to that produced by the normal isolate MMBF 01/01, and the smallest area of laccase was produced by the normal isolate LFEEI016 (747.2 mm2). In vitro production of the enzyme laccase was related to the disease severity caused by the isolates in the plant, which reinforces the need of further in vitro studies to prove the role of laccase in the pathogenicity of the fungus C. spathiphylli in spathiphyllum.

RESUMOOs fungos fitopatogênicos habitantes de solo causam perdas econômicas em muitas culturas e são difíceis de serem controlados. Esses fungos podem ser agrupados pelos sintomas comuns que causam nas plantas, bem como pelas enzimas extracelulares que podem produzir. O objetivo do trabalho foi verificar a produção in vitro de enzimas extracelulares por fungos de solo e tentar relacionar essas enzimas com os sintomas que cada fungo causa em planta hospedeira. O ensaio foi delineado em esquema inteiramente casualizado, com dois fatores, sete fungos (Cylindrocladium spathiphylli, Rhizoctonia solani, Sclerotium rolfsii, Ceratocystis fimbriata, Sclerotinia sclerotiorum, Fusarium oxysporum f. sp. dianthi e Verticillium dahliae) mais testemunha e seis enzimas (amilase, carboximetilcelulase, lipase, lacase, catalase e gelatinase) com 10 repetições. Catalase e gelatinase foram mensuradas por escala de notas, enquanto que as demais pelo cálculo da área da coroa circular. O ensaio foi repetido e a análise foi realizada com os dados de dois ensaios. Os fungos que causam podridão na raiz ou no colo da planta apresentaram maior produção de lacase, enquanto os que causam obstrução, fendas ou até a destruição do sistema vascular demonstraram a prevalência da lipase.

ABSTRACTSoilborne phytopathogenic fungi cause economical losses to several crops and are difficult to control. These fungi can be grouped according to the common symptoms they cause in plants, as well as to the extracellular enzymes they can produce. The aim of this study was to verify the in vitroproduction of extracellular enzymes for soilborne fungi and to relate these enzymes to the symptoms that each fungus causes in the host plant. The assay was conducted in completely randomized design, including two factors, seven fungi (Cylindrocladium spathiphylli, Rhizoctonia solani, Sclerotium rolfsii, Ceratocystis fimbriata, Sclerotinia sclerotiorum, Fusarium oxysporum f. sp. dianthi and Verticillium dahliae) plus control and six enzymes (amylase, carboxymethyl cellulase, lipase, laccase, catalase and gelatinase) with 10 replicates. Catalase and gelatinase were measured based on a score scale, while the other enzymes were analyzed by calculating the circular crown area (mm2). The assay was repeated twice and statistical analysis was done by using data of both assays. The fungi that cause root and collar rot presented greater laccase production, while those that cause obstruction, fissure and even destruction of the vascular system demonstrated prevalence of lipase.

O quiabeiro é suscetível a várias doenças que podem causar prejuízos ao agricultor, caso não sejam manejadas. Objetivaram-se avaliar o efeito da temperatura e a reação de genótipos de quiabeiro ao mofo branco. Plantas de 30 dias inoculadas na região do colo, com e sem ferimento, com dois isolados de Sclerotinia sclerotiorum, foram mantidas por duas semanas nas temperaturas de 15; 20; 25; 30 ou 35ºC. Quatorze genótipos de quiabeiro com um e dois meses de emergência, assim como frutos no ponto de colheita comercial tiveram seus comportamentos avaliados quanto à doença. Avaliaram-se a incidência de plantas com tombamento ou mortas e o comprimento da lesão nos frutos inoculados. A doença foi favorecida por temperaturas entre 15 e 20ºC e, de maneira geral, não foram observadas diferenças entre os isolados e influência do ferimento na ocorrência da doença. Não foram encontrados genótipos de quiabeiro resistentes ao mofo branco, pois todos apresentaram incidência superior a 30% de plantas mortas, sendo as plantas mais novas mais suscetíveis, e comprimento de lesão nos frutos >6,0 cm. Entretanto, diferenças de suscetibilidade entre os genótipos foram observadas em plantas de 30 e de 60 dias e podem ser informações úteis aos produtores para escolha de cultivares em clima ameno, assim como ser exploradas em programas de melhoramento.

The okra plant is susceptible to several diseases that can cause losses to the farmer if not managed. This study aimed to evaluate the effect of temperature and the reaction of okra genotypes to white mold. Plants aged 30 days, inoculated in the collar region, injured or not, including two strains of Sclerotinia sclerotiorum, were maintained for two weeks at temperatures of 15, 20, 25, 30 or 35ºC. Fourteen okra genotypes at one and two months after emergence, as well as fruits at commercial harvest time, had their behavior evaluated for the disease. Damping-off or dead plants were evaluated, as well as the injure length in the inoculated fruits. The disease was favored by temperatures between 15 and 20ºC and, in general, no differences were observed between the isolates and the influence of the injury on the disease occurrence. There were no okra genotypes resistant to white mold, since all of them had more than 30% of incidence of dead plants; younger plants were more susceptible and the injure length in fruits was > 6.0 cm. However, differences in the susceptibility between genotypes were observed for plants aged 30 and 60 days, which could constitute useful information for producers in the choice of cultivars under moderate climate and could be explored in breeding programs.

Atualmente, grupamento de anastomose (AG) de Rhizoctonia sp. em crisântemo e ocorrência deste fungo em gipsófila ainda não foram relatados no Brasil. Assim, realizou-se teste de patogenicidade normal e cruzada e sequenciamento da região ITS-5.8S rDNA para identificar o AG de isolado obtido de plantas de crisântemo (Papiro Branco) e de gipsófila, ambas originárias de Holambra / São Paulo, Brasil. Após os testes, relata-se pela primeira vez a ocorrência de R. solani AG-4 HG I em crisântemo (Papiro Branco e Amarelo) e R. solani AG-4 HG III em gipsófila, no estado de São Paulo, Brasil, e, também, a sua patogenicidade cruzada.

Currently, anastomosis groups (AG) of Rhizoctonia sp. on chrysanthemum and occurrence of this fungus on gypsophila have not been reported in Brazil. However, in the present study, normal and cross pathogenicity and sequencing of ITS-5.8S rDNA regions were used to confirm the AG of isolate of Rhizoctonia sp. obtained from chrysanthemum (White Papyrus) and from gypsophila plants cultivated in Holambra / São Paulo, Brazil. After these tests, it was confirmed the report of Rhizoctonia solani AG-4 HG I on chrysanthemum (White and Yellow Papyrus) and R. solani AG-4 HG III on gypsophila in the São Paulo state, Brazil, and also their cross pathogenicity.

O fungo Cylindrocladium spathiphylli causa podridão no colo e nas raízes de espatifilo, induzindo amarelecimento e murcha nas folhas da parte aérea. Há poucos estudos com o fungo quanto às enzimas extracelulares. Assim, delineou-se ensaio inteiramente casualizado in vitro, com três tratamentos (dois isolados normais: LFEEI016 - EPAGRI/SC e MMBF 01/01 - IB/SP; mais testemunha) e seis repetições, visando a detecção de enzimas. A amilase (AM), lipase (LP), carboximetilcelulase (CMC) e lacase (LC) foram mensuradas pelo cálculo da área da coroa circular, local de atividade das enzimas. A catalase (CT) e gelatinase (GL) foram mensuradas por símbolos, depois transformados em notas (1 a 4, de ausência à intensa produção). O isolado MMBF 01/01 produziu as maiores áreas e com mais intensidade as enzimas. Das enzimas, a maior área foi a da LC e depois a LP. LFEEI016 e MMBF 01/01 não apresentaram área para AM e CMC e exibiram intensidade fraca e igual para CT. A intensidade de GT foi moderada no MMBF 01/01 (nota média 3,0) e ausente para o LFEEI016 (nota média 1,0). Após a produção das enzimas extracelulares, os isolados foram alterados vegetativamente por temperatura. Instalou-se ensaio inteiramente ao acaso, em fatorial contendo disco de micélio dos isolados do fungo versus três temperaturas [23ºC (T1); 33ºC (T2) e de 33ºC para 23ºC (T3)] versus quatro períodos (3; 6; 9 e 12 dias), com oito repetições, em placa de Petri com BDA mantida em BOD. O diâmetro das colônias foi medido diariamente (mm) em dois sentidos. As alterações de temperatura vistas foram: inócuo, fungistático (FS) e fungicida (FC). Aplicou-se estatística nas temperaturas T1 e T3 dos isolados para checar efeito FS e escolher aqueles com maior e menor efeito. O isolado LFEEIO16 mostrou efeito FS com três dias às temperaturas 33ºC e de 33ºC para 23ºC. Nos demais períodos, o isolado sofreu efeito FC. O MMBF 01/01 mostrou efeito FS em todos os períodos. Ambos isolados sofreram, estatisticamente, efeito FS. O MMBF 01/01 mostrou maior efeito FS aos nove dias, nas temperaturas referidas e menor com três dias. Após a constatação de alteração na taxa de crescimento micelial dos isolados, procurou-se verificar, novamente, a produção de enzimas extracelulares. Os isolados alterados e utilizados foram o MMBF 01/01 com três e nove dias e o LFEEIO16 com três dias. A produção e a avaliação das enzimas foram realizadas da mesma maneira para os isolados normais. O isolado MMBF 01/01 - três dias produziu as maiores áreas e com mais intensidade as enzimas. Das enzimas, a maior área foi a da LC. Após LC, a área da LP foi maior que a da CMC nos isolados. Não se detectou área de AM nos isolados. A intensidade de GL foi maior que a da CT nos isolados MMBF 01/01 com três e nove dias. Para LFEEI016 - três dias, a intensidade média de CT foi nota 2,0 e ausência de GL (nota média 1,3). Sugere-se investigar a severidade da doença na planta entre os isolados e em condições naturais investigar a evolução da LC em comparação as demais enzimas na patogênese do fungo na cultura.

The fungus Cylindrocladium spathiphylli causes collar and root rot in spathe flowers, inducing yellowing and wilting of leaves in the shoot. This fungus has been scarcely studied for extracellular enzymes. Therefore, an in vitro assay was carried out in randomized design, with three treatments (two normal isolates: LFEE1016 - EPAGRI and MMBF 01/01 - IB/SP; plus control) and six replicates, for enzyme detection. Amylase (AM), lipase (LP), carboxymethylcellulase (CMC) and laccase (LC) were measured by calculating the annulus area, the activity site of the enzymes. Catalase (CT) and gelatinase (GL) were measured by symbols subsequently transformed into scores (1 to 4, from absence to intense production). MMBF 01/01 isolate had the largest areas and enzymes with the highest intensity. Of the enzymes, the largest area was that of LC, followed by LP. LFEEI016 and MMBF 01/01 showed no area for AM and CMC and exhibited weak and equal intensity for CT. The intensity of GT was moderate for MMBF 01/01 (mean score 3.0) and absent for LFEEI016 (mean score 1.0). After production of extracellular enzymes, the isolates were vegetatively altered by temperatures. The assay was in completely randomized factorial design including mycelial discs of the fungal isolates versus three temperatures [23ºC (T1), 33ºC (T2) and 33ºC to 23ºC (T3)] versus four periods (3, 6, 9 and 12 days) and eight replicates in a Petri dish containing PDA and maintained in a BOD chamber. The diameter of colonies was daily measured (mm) in both directions. The noted changes were: innocuous, fungistatic (FS) and fungicide (FC) effect. Statistics was used for temperatures T1 and T3 to verify FS effect and choose the isolates that had higher and lower effect. LFEEI016 isolate showed FS effect at three days at temperatures 33ºC and from 33ºC to 23ºC. In the remaining periods, this isolate suffered FC effect. MMBF 01/01 showed FS effect in all periods. Both isolates statistically showed FS effect. MMBF 01/01 showed higher FS effect at nine days, at the mentioned temperatures, and lower effect at three days. After detection of the change in the mycelial growth rate of the isolates, the production of extracellular enzymes was again verified. The changed isolates were MMBF 01/01 at three and nine days and LFEEI016 at three days. Enzyme production and evaluation were carried out as for normal isolates. MMBF 01/01 isolate - three days, produced the largest areas and enzymes with the highest intensity. Of the enzymes, the largest area was that of LC. Following LC, the area of LP was larger than that of CMC in the isolates. The area of AM was not detected in the isolates. The intensity of GL was higher than that of CT in MMBF 01/01 isolates at three and nine days. For LFEEI016 - three days, the mean intensity of CT was score 2.0 and absence of GL (mean score 1.3). The disease severity should be investigated in the plant among isolates, as well as under natural conditions to determine the evolution of LC compared to the remaining enzymes in the pathogenesis of this fungus in the culture.

Além das brassicaceas associadas à solarização do solo, novos materiais vegetais como a mandioca e a mamona têm apresentado potencial no controle de fitopatógenos de solo. Assim, objetivou-se verificar os efeitos da incorporação e decomposição de parte aérea de brócolis, mamona e mandioca brava e mansa, associadas à solarização, em conjuntos de microcosmos, sob condições de ambiente controlado, na sobrevivência das estruturas de resistência de Fusarium oxysporum f. sp. lycopersici Raça 2, Macrophomina phaseolina, Rhizoctonia solani AG-4 HGI e Sclerotium rolfsii; e identificar e apontar o(s) volátil(eis) emanado(s) pela decomposição dos materiais, que poderia(m) estar correlacionado(s) com a inativação dos fitopatógenos. Quanto à sobrevivência dos patógenos, quatro ensaios idênticos foram instalados nos microcosmos, com quatro períodos de exposição independentes (7, 14, 21 e 28 dias). A identificação dos voláteis contou com ensaios realizados sob as mesmas condições da sobrevivência, mas em frascos âmbar e com cromatografia gasosa com detectores por espectrometria de massas (GC-MS) e por ionização em chama (GC-FID), utilizando a técnica de Microextração em Fase Sólida - SPME. Os tratamentos solo+materiais vegetais, ao longo dos períodos testados, reduziram a sobrevivência das estruturas de resistência de todos os fungos. No geral, destacaram-se o brócolis e a mandioca brava, além da mandioca mansa para S. rolfsii. Os voláteis identificados foram oriundos da decomposição de brócolis, mamona e mandioca mansa. Foram identificados 26, 37 e 29 compostos voláteis para brócolis, mamona e mandioca mansa, respectivamente. Correlações positivas e negativas foram observadas entre alguns voláteis e a média dos compostos com a sobrevivência das estruturas de resistência dos fitopatogênicos.

In addition to Brassicaceae species associated with soil solarization, new materials from plants such as cassava and castor bean have shown potential to control soil phytopathogens. Thus, the present study aimed to verify the effects of incorporation and decomposition of shoot of broccoli, castor bean, and bitter and sweet cassava, associated with solarization in microcosm sets under controlled environment conditions, on the survival of resistance structures from Fusarium oxysporum f. sp. lycopersici Race 2, Macrophomina phaseolina, Rhizoctonia solani AG-4 HGI and Sclerotium rolfsii; and to identify volatile compound(s) released by the decomposition of materials, which could be related to phytopathogen inactivation. As to pathogen survival, four identical assays were installed in the microcosms, with four independent exposure periods (7, 14, 21 and 28 days). To identify volatile compounds, assays were performed under the same survival conditions, but using amber glass bottles and gas chromatography with mass spectrometry (GC-MS) and flame ionization detectors (GC-FID), and adopting the Solid-Phase Microextraction Technique - SPME. The treatments soil+plant materials, over the tested periods, reduced the survival of resistance structures for all fungi. In general, expressive results were found for broccoli and bitter cassava, as well as sweet cassava against S. rolfsii. The identified volatile compounds were from broccoli, castor bean and sweet cassava decomposition. The number of volatile compounds identified for broccoli, castor bean and sweet cassava were 26, 37 and 29, respectively. Positive and negative correlations were detected among some volatile compounds and their mean values and the survival of resistance structures from phytopathogens.

A incorporação de materiais vegetais específicos associados à solarização do solo tem sido um avanço promissor no controle de fungos fitopatogênicos habitantes do solo. O objetivo do trabalho foi avaliar determinados efeitos da incorporação e decomposição de brócolis, mamona, mandioca brava e mansa, no solo, em condições de microcosmo mantido em BOD (37±2ºC), sobre o micélio de Fusarium oxysporum f. sp. lycopersici Raça 2, Macrophomina phaseolina, Rhizoctonia solani AG-4 HGI e de Sclerotium rolfsii. Assim, quatro ensaios idênticos foram instalados em conjunto de microcosmos, com cinco tratamentos e quatro períodos de tempo diferentes e independentes (7, 14, 21 e 28 dias). O parâmetro avaliado foi os efeitos inócuo, fungistático e fungicida dos tratamentos sobre o micélio dos fungos. Verificou-se efeito fungistático e fungicida no crescimento micelial de F. oxysporum f. sp. lycopersici Raça 2, R. solani AG-4 HGI e de S. rolfsii. Os fungos que apresentaram efeito fungistático apresentaram uma velocidade média de crescimento micelial inferior ao controle geral, que consistiu na incubação dos fungos em temperatura de 25±2ºC. O efeito fungicida ocorreu aos 21 dias de incubação para F. oxysporum e R. solani e aos 28 dias para S. rolfsii. Para M. phaseolina, observou-se apenas efeito inócuo. Associação da temperatura de 37±2ºC mais o período de tempo dos tratamentos foi o fator responsável pelos efeitos fungistático e fungicida no micélio dos fitopatógenos estudados. Essa associação também interferiu na velocidade do crescimento micelial dos fungos que apresentaram efeito fungistático.

The incorporation of plant materials associated with soil solarization has been a promising progress to control soilborne phytopathogenic fungi. The aim of this study was to evaluate certain effects of incorporation and decomposition of broccolis, castor bean, wild and sweet cassava, in the soil, under microcosm conditions maintained in BOD (37±2ºC), on the mycelium of Fusarium oxysporum f. sp. lycopersici race 2, Macrophomina phaseolina, Rhizoctonia solani AG-4 HGI and Sclerotium rolfsii. Thus, four identical experiments were established with five treatments of four different and independent periods (7, 14, 21 and 28 days). The assessed parameter was the innocuous, fungistatic and fungicide effects of the treatments on the mycelium of fungi. Fungistatic and fungicide effect was verified for the mycelium of F. oxysporum f. sp. lycopersici race 2, R. solani AG-4 HGI and S. rolfsii. Fungi with fungistatic effect presented lower velocity of mycelial growth compared to the general control, which consisted of incubation of the fungi at a temperature of 25±2ºC. Fungicide effect occurred at 21 days of incubation for F. oxysporum and R. solani and at 28 days for S. rolfsii. Only innocuous effect was observed for M. phaseolina. The factor that caused fungistatic and fungicide effect on the mycelium of fungi was the association of the temperature of 37±2ºC with the period of the treatments. That association also interfered in the mycelial growth velocity of the fungi that showed fungistatic effect.

A baixa produtividade do maracujazeiro-amarelo é devida, muitas vezes, a problemas fitossanitários, sendo a Podridão-do-colo, causada por Nectria haematococca, um dos principais problemas na maioria dos Estados produtores do Brasil. O controle desta doença é basicamente preventivo, evitando a introdução do agente patogênico na área. Sendo assim, o presente trabalho teve como objetivos: a) avaliar o comportamento do maracujazeiro-amarelo 'Afruvec', 'IAC 275' e 'Maguary', do tipo pé-franco, e 'Afruvec' enxertado em cinco espécies de Passiflora (P. alata, P. maliformis, P. morifolia, P. mucronata e P. suberosa), em pomar com histórico de Podridão-do-colo; e b) avaliar a eficiência de produtos químicos (oxicloreto de cobre, procloraz e tiabendazol) e biológicos (Trichoderma harzianum e Trichoderma sp.) no controle da Podridão-do-colo em maracujazeiro-amarelo 'Afruvec', sob condições de campo. As espécies P. maliformis, P. suberosa e P. alata, empregadas como porta-enxerto, apresentaram maior resistência à Podridão-do-colo do maracujazeiro em relação às plantas não enxertadas. Os produtos químicos e biológicos, aplicados em intervalos mensais ou quinzenais no colo da planta (500 mL de calda), não foram eficientes no controle da doença.

The low productivity of yellow passion fruit is due often to the phytosanitary problems, being the Collar rot caused by Nectria haematococca, one of the main problems in the majority of the producing States of Brazil. The disease control is basically preventive, avoiding the introduction of the pathogen in the area. So, the present work aimed at: a) evaluating the behavior of ungrafted yellow passion fruit cultivars 'Afruvec', 'IAC 275' and 'Maguary' and 'Afruvec' passion fruit grafted on five Passiflora species (Passiflora alata, P. maliformis, P. morifolia, P. mucronata and P. suberosa) in orchard where the disease is frequent; and b) evaluating the efficiency of chemical (copper oxychloride, prochloraz and thiabendazole) and biological products (Trichoderma harzianum and Trichoderma sp.) in the control of Collar rot in 'Afruvec' yellow passion fruit in field conditions. Yellow passion fruit grafted on P. maliformis, P. suberosa and P. alata presented greater resistance to the Collar rot in relation to the ungrafted yellow passion fruit. The chemical and biological products applied to the base of plants (500 ml of volume) in monthly or biweekly intervals were not efficient in reducing the disease occurrence.

O presente trabalho foi conduzido em casa-de-vegetação da APTA/Bauru, Estado de São Paulo, no primeiro semestre de 2007, com o objetivo de avaliar a resistência de duas variedades de maracujá-amarelo, Maguari e Afruvec, ao complexo Fusarium solani-Meloidogyne incognita raça 3. O delineamento experimental foi o inteiramente casualizado em esquema fatorial de 2 x 4, com quatro ou cinco repetições, sendo a parcela constituída por um vaso com uma planta. Avaliou-se a severidade da fusariose, medindo-se o comprimento da lesão (cm) no colo da planta e o número de galhas no sistema radicular. As duas variedades mostraram-se suscetíveis a F. solani. Apenas na variedade Afruvec, a presença do nematoide resultou em aumento da fusariose. Quanto à reação ao nematoide,'Maguari' comportou-se como resistente, tanto na presença como na ausência do fungo. Ao contrário, para a variedade Afruvec, a presença do fungo resultou em diminuição da resistência ao nematoide, passando de moderadamente resistente para suscetível.

The present work was conducted in greenhouse conditions at APTA/Bauru, São Paulo State, during the first semester of 2007, with the objective of evaluating the resistance of two varieties of yellow passion fruit, Maguari and Afruvec, to the Fusarium solani-Meloidogyne incognita race 3 complex. The experimental delineation was entirely randomized in a 2 x 4 factorial arrangement, with 4-5 repetitions, with the plot constituted by 1 vase containing 1 plant. The appraised parameters in the assay were disease severity, caused by F. solani, measuring the lesion length (cm) in the collar zone of plants and number of galls formed by M. incognita race 3 in the root system. The two varieties of yellow passion fruit showed susceptibility to F. solani. Only in the Afruvec variety, the presence of nematode resulted in increase of fusariosis. As for resistance to the phytonematode, the Maguary variety was classified as resistant in the presence or absence of Fusarium. In contrast, for the Afruvec variety, the presence of Fusarium resulted in reduction of resistance to the nematode, going from moderately resistant to susceptible.

Uma das principais doenças do maracujazeiro, na maioria dos estados produtores do Brasil, é a podridão do colo, causada por Fusarium solani. Pouco se sabe a respeito da fisiologia deste patógeno do maracujazeiro amarelo, principalmente quanto à produção de enzimas extracelulares. O objetivo do presente trabalho foi verificar, em meios de cultura individuais e apropriados, a produção das enzimas extracelulares amilase, lipase, celulase, proteases (caseinase e gelatinase), lacase (oxidase) e catalase por isolados de F. solani, provenientes de maracujazeiro amarelo. O delineamento experimental adotado foi o inteiramente casualizado, em esquema de dois fatores (nove isolados versus sete enzimas), com três repetições. Todos os isolados de F. solani produziram, de maneira semiquantitativa, as enzimas extracelulares amilase, lipase, celulase, caseinase (protease) e lacase (oxidase). No entanto, a quantidade produzida de cada enzima foi significativamente diferente entre os isolados. As enzimas extracelulares gelatinase (protease) e catalase foram produzidas em pouca quantidade e de maneira igual por todos os isolados do fungo.

In most Brazilian producer states, one of the main diseases of the passion fruit is collar rot caused by Fusarium solani. Little is known about the physiology of this pathogen from yellow passion fruit, which mainly involves the production of extracellular enzymes. The objective of this work was to verify, in individual and appropriate culture media, the production of the extracellular enzymes amylase, lipase, cellulase, proteases (caseinase and gelatinase), lacase (oxydase) and catalase by isolates of F. solani from yellow passion fruit. The experimental design adopted was an entirely randomized two-factor scheme (nine isolates and seven enzymes) with three repetitions. All the isolates of F. solani produced, in a semi-quantitative manner, the extracellular enzymes amylase, lipase, cellulase, caseinase (protease) and lacase. However, the amount of each enzyme produced was significantly different among the isolates. The extracellular enzymes gelatinase (protease) and catalase were produced in a small amount and in an equal manner by all the isolates of the fungus.