BACKGROUND Zika virus (ZIKV) was discovered in 1947 with the virus isolation from Rhesus monkey (Macaca mulatta) in Uganda forest, Africa. Old World Primates are involved in a sylvatic cycle of maintenance of this arbovirus, however a limited knowledge about the role of New World primates in ZIKV transmission cycles has been established. OBJECTIVE This work aimed to investigate the presence of enzootic circulation of ZIKV in New World Primates from three Brazilian states: São Paulo, Paraíba, and Paraná. METHODS We analyzed 100 non-human primate samples collected in 2018 and 2020 from free-ranging and captive environments from São Paulo (six municipalities belonging to Sorocaba region), Paraíba (João Pessoa municipality), and Paraná (Foz do Iguaçu municipality) using reverse transcriptase quantitative polymerase reaction (RT-qPCR) assays, indirect enzyme-linked immunosorbent assay (ELISA), and plaque reduction neutralization test (PRNT). FINDINGS All samples (n = 141) tested negative for the presence of ZIKV genome from tissue and blood samples. In addition, all sera (n = 58) from Foz do Iguaçu’ non-human primates (NHPs) were negative in serological assays. MAIN CONCLUSION No evidence of ZIKV circulation (molecular and serological) was found in neotropical primates. In addition, the absence of antibodies against ZIKV suggests the absence of previous viral exposure of NHPs from Foz do Iguaçu-PR.

RESUMO: O tumor venéreo transmissível canino (TVTC) se trata de uma neoplasia transmissível, que se propaga naturalmente entre os cães pela transferência halogênica de células tumorais, principalmente, durante o coito. É a mais antiga linhagem tumoral conhecida na natureza e relatos sobre mutações gênicas vêm sendo ampliadas. Além disso, este tumor compartilha uma série de mutações genéticas com alguns cânceres em seres humanos, dentre eles, carcinomas de pulmão, melanoma, próstata, mama, entre outros tipos de câncer. Assim, quantificou-se a expressão de genes supressores de tumores, como TP53, P21 e genes relacionados à apoptose, como BAX, BCL-2 e BCL-xL, tanto in vivo quanto in vitro (cultura celular primária). No presente estudo, na comparação das expressões gênicas, o gene TP53 se mostrou elevado na maioria dos casos em tecidos (65%) e em cultura celular primária (100%), enquanto BCL-2, BCL-xL e BAX apresentaram-se variáveis entre os animais analisados. Ademais, nessas situações os resultados sugerem que não ocorreu regulação apoptótica desses genes pelo TP53. O gene P21 mostrou-se, em sua maioria, normal (70%), embora a ausência (6%) e subexpressões (24%) também tenham sido observadas. A análise estatística do gene BCL-xL demonstrou diferenças significativas entre os tecidos dos animais, quando comparadas às culturas celulares, entretanto, para os demais genes, não foi observada diferença estatística entre os grupos. Preliminarmente, os resultados sugerem a presença de alterações nas expressões gênicas dos genes TP53, P21, BAX, BCL-2 e BCL-xL, levando a perda de função desses genes, os quais afetam a tumorigênese do CTVT.

ABSTRACT: Canine transmissible venereal tumor (CTVT) is a transmissible neoplasm, which spreads naturally between dogs through the halogenic transfer of tumor cells, mainly during coitus. It is the oldest known tumoral lineage in nature and reports on gene mutations have been extended. Also, this tumor shares several genetic mutations with some cancers in humans, among them lung carcinomas, melanoma, prostate, breast, among other cancers. Thus, expression of tumor suppressor genes such as TP53, P21, and apoptosis-related genes such as BAX, BCL-2, and BCL-xL, both in vivo and in vitro (primary cell culture) were quantified. In the present study, the comparison of gene expression, the TP53 gene, in most cases, was shown to be high in the majority of tissues (65%) and primary cell culture (100%), while BCL-2, BCL-xL, and BAX presented variation among the animals analyzed. Moreover, in these situations, the results suggested that the apoptotic regulation of these genes did not occur for TP53. The P21 gene was shown to be mostly normal (70%); although, absence (6%) and underexpressions (24%) were also observed. Statistical analysis of the BCL-xL gene demonstrated significant differences between the tissues of the animals when compared to the cell cultures; however, to the other genes, no statistical difference was observed between the groups. Preliminarily, the results suggested the presence of alterations in the gene expressions of the TP53, P21, BAX, BCL-2 and BCL-xL leading to loss of function in these genes, which affect the tumorigenesis of CTVT.

RESUMO: Como o Canine circovirus (CanineCV) é uma nova espécie do Gênero Circovirus, várias questões relacionadas com a sua epidemiologia, patogenia e doença clínica permanecem desconhecidas. Assim, este estudo objetivou realizar a caracterização da primeira sequência do genoma completo do CanineCV detectado em um cão com diarreia, no Brasil. Uma amostra de fezes foi coletada de um cão da raça Pastor Alemão, fêmea, 10 meses de idade, o qual tinha sinais de gastroenterite hemorrágica intermitente, vômito e uma história de ingestão de carne crua de porco. O genoma completo do CanineCV foi sequenciado pelo Sequenciamento de Nova Geração. A sequência tinha 2.063 nucleotídeos, apresentou uma organização genômica típica para um circovírus e foi agrupado com a cepa 214, descrita nos Estados Unidos pela análise filogenética. Uma mudança de aminoácido foi encontrada na proteína de replicação e por causa disso ela foi considerada única para o CanineCV. Portanto, a caracterização do genoma completo do CanineCV brasileiro pode ser utilizada em futuros estudos de epidemiologia molecular, patogenia e no desenvolvimento de ferramentas de diagnóstico para prevenção e controle desta doença.

ABSTRACT: Because Canine circovirus (CanineCV) is a new species of the genus Circovirus, several issues related to its epidemiology, pathogenesis and clinical disease remain unknown. Thus, this study aimed to perform the characterization of the first complete genome sequence of CanineCV detected in a dog with diarrhea in Brazil. A stool sample was collected of a ten-month-old female German Shepherd dog which had signs of intermittent hemorrhagic gastroenteritis, vomiting, and a history of eating raw pork. The complete CanineCV genome was sequenced by Next-Generation Sequencing. The sequence had 2,063 nucleotides, showed a typical genomic organization for circovirus, and was grouped with strain 214 described in the United States by phylogenetic analysis. One amino acid change was found in the replicase protein, and because of that it was considered unique to CanineCV. Therefore, the characterization of the complete genome of Brazilian CanineCV can be used in future studies of molecular epidemiology, pathogenesis and development of diagnostic tools for the prevention and control of this disease.

RESUMO: Três kits comerciais de One-Step RT-qPCR foram avaliados para o diagnóstico molecular do Vírus da Cinomose Canina.Utilizando o kit que apresentou melhor desempenho, dois sistemas de RT-PCR em tempo real (RT-qPCR) foram comparados quanto à sensibilidade analítica na detecção do RNA do Vírus da Cinomose Canina:One-Step RT-qPCR (Sistema A) e One-Step RT-qPCR seguido da NESTED-qPCR (Sistema B).Os limites de detecção dos dois sistemas foram determinados utilizando diluição seriada de RNA sintético do Vírus da Cinomose Canina ou de uma amostra de urina positiva. Adicionalmente, uma amostra de urina foi avaliada com centrifugação ou ultracentrifugação prévia. Os kits comerciais de One-Step RT-qPCR amplificaram o RNA do vírus da cinomose canina em 10 (100%) amostras de urinas de animais sintomáticos. O kit de One-Step RT-qPCR que apresentou melhor resultado foi utilizado para avaliar a sensibilidade analítica dos sistemas A e B. Na reação da curva padrão com RNA sintético, o limite de detecção do sistema A foi de 11 cópias de RNA µL-1. No sistema B foi de 110 cópias de RNA µL-1 na One-Step RT-qPCR e 11 cópias de RNA µL-1 na NESTED-qPCR. A relação entre os valores de Ct e concentração de RNA foi linear. O RNA extraído das diluições da urina foi detectado nas diluições de 10-3 e10-2 pelos sistemas A e B, respectivamente. A centrifugação prévia da urina aumentou a sensibilidade analítica da análise e mostrou ser importante para a rotina diagnóstica. A reação de One-Step RT-PCR é um método rápido, sensível, específico e aplicável na rotina de diagnóstico molecular da cinomose e em projeto de pesquisa que requer metodologia quantitativa e sensível.

ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR) assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A) and a One-Step RT-qPCR combined with NESTED-qPCR (system B). Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100%) urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

No presente estudo foram identificadas espécies e genótipos de Cryptosporidium originadas de bovinos leiteiros na região central do estado de São Paulo, Brasil. Amostras fecais foram coletadas de 200 animais (100 bezerros e 100 vacas) em 10 propriedades leiteiras. As amostras foram examinadas utilizando os métodos de microscopia óptica (MO), ensaio imunoenzimático (EI) e reação em cadeia da polimerase (PCR). As espécies e genótipos de Cryptosporidium foram determinados pelo método de polimorfismo no tamanho dos fragmentos de restrição (RFLP) ou sequenciamento dos genes SSU-rRNA e GP60. A infecção por Cryptosporidium spp. teve ocorrência de 14% (28/200). A ocorrência em bezerros (26%) foi significativamente maior do que em vacas (2%). Do total de 27 amostras positivas submetidas à caracterização genética, C. andersoni foi identificado em 23 (85.1%), C. bovis em três (11.1%) e C. parvum subtipo IIaA15G2R1 em uma (3.7%). O presente estudo demonstrou que a infecção por Cyptosporidium é comum e difundida em bovinos leiteiros nessa região e que bezerros possuem uma alta prevalência de C. andersoni. A presença de C. parvum subtipo IIaA15G2R1 indica que bezerros leiteiros dessa região devem ser considerados uma fonte de oocistos deCryptosporidium com potencial zoonótico.

In this study, we identified Cryptosporidium species and genotypes present in dairy cattle in the central region of São Paulo state, Brazil. Fecal specimens were collected from 200 animals (100 calves and 100 cows) in ten dairy farms. Fecal samples were examined using microscopic examination (ME), enzyme immunoassay (EIA) and polymerase chain reaction (PCR). Cryptosporidiumspecies and genotypes were determined by restriction fragment length polymorphism (RFLP) or DNA sequencing analysis of the SSU-rRNA and GP60 genes. The occurrence of Cryptosporidium spp. infection was 14% (28/200). The occurrence in calves (26%) was significantly higher than in cows (2%). Of the 27 Cryptosporidium-positive specimens submitted to genotyping, C. andersoni was identified in 23 (85.1%), C. bovis in three (11.1%), and the zoonotic C. parvum subtype IIaA15G2R1 in one (3.7%). The study demonstrates thatCryptosporidium spp. infection was common and widespread in dairy cattle in this region and that calves have a high prevalence of C. andersoni. Furthermore, the presence of C. parvumsubtype IIaA15G2R1 indicates that dairy calves from this region should be considered a potential source of zoonotic Cryptosporidiumoocysts.

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.