Resumo Os pássaros são indicadores muito valiosos da riqueza de espécies e padrões endêmicos em um determinado ecossistema, o que acaba ajudando o cientista a medir a degradação ambiental. O objetivo do presente estudo foi conhecer o conhecimento humano e a atitude em relação às aves urbanas na cidade de Faisalabad, Paquistão. O estudo foi conduzido em quatro meses consecutivos: novembro de 2019 a fevereiro de 2020. A população de pássaros foi observada em oito cidades residenciais da cidade de Faisalabad, os dados foram coletados por meio de questionário. Faisalabad tem uma população razoavelmente grande de pássaros, e os dados atuais mostram que há uma diferença significativa entre as aves favoritas de áreas residenciais e instituições. O pombo recebeu mais semelhanças na população de pássaros entre os residentes de áreas residenciais, enquanto o myna recebeu menos. A ave mais popular nas instituições de Faisalabad era o pardal, enquanto a ave menos popular era o myna comum. A porcentagem de adaptação de pássaros em áreas residenciais e institucionais de Faisalabad foi a mais alta para papagaios e pardais, respectivamente. As pessoas em áreas residenciais e instituições, por outro lado, se adaptaram menos ao myna comum. Conclui-se que pessoas da área de estudo como pássaros e alimentos oferecidos e alta população de pássaros estão presentes na área de estudo.

Abstract Birds are very valuable indicators of species richness and endemic patterns in a specified ecosystem, which eventually help the scientist to measure the environmental degradation. The aim of present study was to know human knowledge and attitude toward urban birds in Faisalabad city, Pakistan. The study conducted in four consecutive months: November 2019 to February 2020. Population of birds was noted from eight residential towns of Faisalabad city, data were collected through questionnaire. Faisalabad has a reasonably large population of birds and present data show that, there is a significant difference between favorite bird of residential areas and institutions. The pigeon received the most likeness in bird population among residential area residents, while the myna received the least. The most popular bird in Faisalabad institutions was the sparrow, while the least popular bird was the common myna. Bird adaptation percentage of residential areas and institutional areas of Faisalabad was the highest for parrot and sparrow respectively. People in residential areas and institutions, on the other hand, adapted least to common myna. It is concluded that people of the study area like birds and offered food and high population of birds are present in study area.

RESUMO O presente estudo foi realizado para investigar o efeito da estação do ano e do sistema de alojamento nos atributos hemato-químicos dos coelhos no Sul do Punjab, Paquistão. Os coelhos adultos saudáveis (n=30) foram divididos em dois grupos de mesmo tamanho (n=15). O grupo I foi alojado em um moderno sistema de gaiolas e o grupo II em sistema de colônia tradicional por um período de um ano. Amostras de sangue de coelhos em ambos os grupos foram coletadas no verão e no inverno e analisadas para vários atributos hemato-químicos. Os atributos hemato-químicos, incluindo contagem de hemácias, hematócrito (HCT), volume corpuscular médio (MCV), contagem total de leucócitos, células mistas (MID), granulócitos (GRA), glicose e alanina aminotransferase (ALT) foram significativamente reduzidos (P<0.05) no verão comparado ao inverno, enquanto a hemoglobina corpuscular média (HGM), a concentração média de hemoglobina corpuscular (HGM), creatinina e nível de colesterol foram significativamente (P<0,05) mais altos durante a estação do verão. Atributos bioquímicos como colesterol, triglicerídeos e globulina foram significativamente (P<0,05) mais baixos em coelhos engaiolados. Em conclusão, a estação do verão causou uma diminuição significativa na maioria dos atributos hemato-químicos, enquanto o sistema de alojamento não afetou a maioria dos atributos hemato-químicos dos coelhos sob as condições climáticas do Punjab do Sul, Paquistão.

ABSTRACT The present study was conducted to investigate the effect of season and housing system on hematochemical attributes of rabbits in Southern Punjab, Pakistan. Adult healthy rabbits (n=30) were divided into two groups of equal size (n=15). Group I was housed in a modern cage system and group II in traditional colony system for a period of one year. Blood samples of rabbits from both groups were collected in the summer and the winter seasons and analyzed for various hematochemical attributes. Hematochemical attributes including red blood cell (RBC) count, hematocrit (HCT), mean corpuscular volume (MCV), total white blood cell (WBC) count, mixed cells (MID), granulocytes (GRA), glucose and alanine aminotransferase (ALT) were lowered significantly (P<0.05) in the summer in relation to the winter, while mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), creatinine, and cholesterol level were significantly (P<0.05) higher during the summer season. Biochemical attributes as cholesterol, triglycerides and globulin were significantly (P<0.05) lower in the caged rabbits. In conclusion, the summer season caused a significant decrease in most of the hematochemical attributes whereas housing system did not affect most of the hematochemical attributes of the rabbits under the climatic conditions of Southern Punjab, Pakistan.

Resumo Uma pesquisa foi realizada para avaliar o impacto de vários níveis de nitrogênio e fósforo, juntamente com micróbios benéficos, para aumentar a produtividade da canola. A pesquisa foi realizada no inverno de 2016-17 no Agronomy Research Farm, Universidade de Agricultura do Peshawar. O experimento foi conduzido por planejamento fatorial aleatorizado em blocos. O estudo focou-se em três fatores, incluindo o teor de nitrogênio, N, (60, 120 e 180 kg.ha-1), o teor de fósforo, P, (70, 100 e 130 kg ha-1) e a presença de micróbios benéficos (com BM e sem BM). Para fins de comparação, um tratamento controle sem N, P e BM também foi incluído no estudo. A aplicação de micróbios benéficos aumentou significativamente as vagens das plantas e de sementes, a duração do enchimento das sementes, o peso de 1000 sementes, o rendimento biológico e o rendimento de sementes em comparação com os resultados do controle. O nitrogênio aplicado na taxa de 180 kg ha-1 aumentou as vagens por planta, vagem, duração do enchimento, peso da semente, rendimento biológico e rendimento de sementes. Vagens máximas por planta, vagem, enchimento precoce de sementes, peso maior de semente, rendimento biológico, rendimento de sementes e índice de colheita foram observados em parcelas tratadas com 130 kg.ha-1 de fósforo. Em comparação aos blocos cultivados de controle, os blocos cultivados tratados combinados têm mais vagens por planta e sementes por vagem, maior duração do enchimento das sementes, maior número de sementes mais pesadas e maior rendimento biológico, rendimento de sementes e índice de colheita. Conclui-se que a aplicação de micróbios benéficos junto com N e P nas doses de 180 kg ha-1 e 130 kg ha-1, respectivamente, aumentou a produtividade e atributos de produtividade para a canola.

Abstract A research was conducted to evaluate the impact of various nitrogen and phosphorus levels along with beneficial microbes to enhance canola productivity. The research was carried out at Agronomy Research Farm, The University of Agriculture Peshawar in winter 2016-2017. The experiment was conducted in randomized complete block factorial design. The study was comprised of three factors including nitrogen (60, 120 and 180 kg ha-1), phosphorous (70, 100 and 130 kg ha-1) and beneficial microbes (with and without BM). A control treatment with no N, P and BM was also kept for comparison. Application of beneficial microbes significantly increased pods plant, seed pod, seed filling duration, 1000 seed weight, biological yield and seed yield as compared to control plots. Nitrogen applied at the rate of 180 kg ha-1 increased pods plant-1, seed pod, seed filling duration, seed weight, biological yield and seed yield. Maximum pods plant-1, seed pod, early seed filling, heavier seed weight, biological yield, seed yield, and harvest index were observed in plots treated with 130 kg.ha-1 phosphorous. As comparison, the combine treated plots have more pods plant-1, seeds pod-1, seed filling duration, heaviest seeds, biological yield, seed yield and harvest index as compared to control plots. It is concluded that application of beneficial microbes with N and P at the rate of 180 kg ha-1 and 130 kg ha-1, respectively, increased yield and its attributes for canola.

The studies aimed to evaluate the pregnancy rate (PR) for timed artificial insemination (TAI) after G7G-Ovsynch, modified G7G-Ovsynch (MG7G-Ovsynch) and Ovsynch protocols and to assess the accuracy of using pregnancy-associated glycoproteins (PAGs) and plasma progesterone (P4) in pregnancy diagnosis compared with ultrasonography (US). In study 1, Holstein cows (n = 37) were bred by TAI following the G7G-Ovsynch protocol (n = 19) or MG7G-Ovsynch (n = 18). Pregnancy was evaluated by US at days 31, 59, and 87 after breeding. The PR was not different for the G7G-Ovsynch and MG7G-Ovsynch. Blood and milk samples were collected on day 3 after insemination and then weekly through day 59 post TAI in cows diagnosed as not pregnant on day 31 and through day 87 in pregnant cows. PAGs were measured using ELISA and P4 by radioimmunoassay (RIA). In the second study, Holstein cows (n = 212) were bred by TAI following G7G-Ovsynch protocol (n = 110) or standard Ovsynch (n = 102). Cows were subjected to pregnancy diagnosis on days 30, 60, and 90. A subset (n = 15 in each group) was subjected to blood and milk samples on days 30, 45, 60, 75, and 90 to measure PAGs and P4. In study 2, PR was not significantly different between synchronization protocols on days 30, 60, and 90. Pregnancy loss averaged 15% between day 30 and day 90. The use of PAGs and P4 proved equally effective in diagnosis of pregnancy. Thus, G7G-Ovsynch was deemed the protocol of choice in postpartum cows, and PAGs assayed in milk or plasma could be used to diagnose pregnancy.

This study was conducted to reveal the dynamics of haematological indicators in pregnant and nonpregnant dairy cows. Sixty multiparous healthy dairy cows were divided into four groups based on the length of time they had been pregnant, namely first, second and third trimesters, and non-pregnant (n=15 each). Blood was collected from each animal, and serum was harvested and stored at -20 °C for biochemical profiling. Concentrations of serum total oxidants (TOC), ceruloplasmin oxidase (CpO) and triiodothyronine (T3) were higher (P <0.05) during the third trimester compared with non-pregnant cows. Serum arylesterase (Ary) concentration was lower (P <0.05) during the second and the third trimesters compared with the non-pregnant cows. The concentration of serum total homocysteine (tHcy) was higher (p <0.05) the third trimester compared with the first and the second trimesters. The concentrations of serum total antioxidants (TAC), paraoxonase 1 (PON1), thyroxine (T4), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were not different in the pregnant and the non-pregnant cows. Thus, TOC, Ary, CpO, tHcy and T3 could be taken as biological markers to assess the progression of pregnancy and to develop management tools to improve health status during late gestation in dairy cows.

The purpose of this trial was to examine the possible effects of exogenous growth hormone (GH) on semen quality, hematological variables and serum testosterone concentration in Nili Ravi buffalo. Bulls of the treatment group (n=3) were injected with recombinant GH 500 mg in a 15 day interval for 10 consecutive weeks, while bulls of control group (n=3) received equal volume of normal saline solution. Semen samples were collected twice per week and analyzed for physiological parameters. Blood samples collected fortnightly were analyzed for red blood cells count (RBC), hemoglobin concentration (Hb), packed cell volume (PCV), mean corpuscular volume (MCV), white blood cell (WBC), neutrophils, lymphocytes, and serum testosterone levels. Data were analyzed statistically using t-test. Results indicated that GH treatment of Nili-Ravi buffaloes significantly (p<0.05) increased ejaculatory volume (8.8±0.2 vs 7.7±0.2 ml), sperm motility (72.6±0.4 vs 67.4±0.7), mass activity (3.35±0.07 vs 2.52±0.08), sperm concentration (982.2±67.8 vs 731.9±50.5 million/ ml), live sperm (80.1±0.3 vs 75.8±0.5) and serum testosterone (4.02±0.21 vs 2.37±0.07 ng/ml) compared to control bulls. Among hematological variables, lymphocytes were increased (p<0.05), but MCV, WBC count, and neutrophils decreased (p<0.05). Hb, RBC and PCV remained unchanged. However, values of these variables were within normal ranges for buffalo bulls. In conclusion, treatment of Nili-Ravi bulls with GH improved semen quality and increased serum testosterone without ostensible adverse effects on the general state.

El propósito de este ensayo fue examinar los posibles efectos de la hormona de crecimiento exógena (GH) sobre la calidad del semen, algunas variables del hemograma y la concentración de testosterona en suero de toros bubalinos Nili Ravi. Los búfalos del grupo tratado (n=3) fueron inyectados con 500 mg de somatotropina recombinante cada 15 días durante 10 semanas consecutivas, mientras que los del grupo control (n=3) recibieron igual volumen de solución fisiológica salina. Las muestras de semen fueron tomadas dos veces por semana y analizadas para evaluar los parámetros fisiológicos. Las muestras de sangre colectadas quincenalmente fueron analizadas para establecer el recuento de glóbulos rojos, la concentración de hemoglobina, el hematocrito, el volumen corpuscular medio (MCV), recuento de glóbulos blancos (WBC), tasa de neutrófilos y linfocitos, así como los niveles séricos de testosterona. Los datos obtenidos fueron analizados estadísticamente por medio del test-t de Student. Los resultados indicaron que el tratamiento con somatotropina aumentó significativamente (p<0,05) el volumen eyaculado (8,8±0,2 versus 7,7±0,2 ml), la motilidad del semen (72,6±0,4 versus 67,4±0,7), la actividad de masa (3,35±0,07 versus 2,52±0,08), la concentración de espermatozoides (982,2±67,8 versus 731,9±50,5 millones/ml), los espermatozoides vivos (80,1±0,3 versus 75,8±0,5) y el nivel de testosterona sérica (4,02±0,21 versus 2,37±0,07 ng/ml), comparados con los animales controles. En el hemograma aumentaron los linfocitos (p<0,05) y disminuyeron variables como volumen corpuscular medio, recuento de leucocitos y tasa de neutrófilos (p<0,05). Hemoglobina, concentración de eritrocitos y hematocrito permanecieron inalterados. Todos los parámetros investigados se situaron dentro de los rangos normales para toros bubalinos. En conclusión, el tratamiento de búfalos Nili-Ravi con somatotropina mejoró la calidad del semen y aumentó la testosterona sérica, sin provocar ostensibles efectos adversos en el estado general de los toros.

Salinity adversely affects physiological and biochemical processes in plants. Plants might have different methods to decrease the harmful effects of salinity, such as the accumulation of osmolytes and antioxidant compounds. An experiment was conducted in the Department of Biological Sciences, University of Sargodha, Pakistan to determine the effect of different levels of phosphorus (P) on wheat under saline conditions. Data of shoot and root fresh and dry weights, chlorophyll contents, different ion accumulation and yield components of wheat were collected. When different levels of phosphorus were applied on wheat plant under saline conditions, phosphorus reduced the effect of salinity. Applications of phosphorus decreased Na+ uptake and increased potassium concentrations, chlorophyll contents and enhanced growth of wheat plants under saline and non-saline conditions. This indicated that application of phosphorus stabilized the physiology of the wheat plants, as phosphorus activated potassium transport in wheat plants. Therefore, application of phosphorus had a positive effect on yield of the wheat plants. In conclusion, all these investigations showed that phosphorus induced the salt tolerance in wheat plants.

La salinidad afecta negativamente a los procesos fisiológicos y bioquímicos en las plantas. Las plantas pueden tener diferentes métodos para disminuir los efectos perjudiciales de la salinidad, tales como acumulación de osmolitos y compuestos antioxidantes. Se realizó un experimento en el Departamento de Ciencias Biológicas, Universidad de Sargodha, Pakistán para determinar el efecto de diferentes niveles de fósforo en el trigo bajo condiciones salinas. Se recogieron datos de diferentes parámetros tales como los pesos seco y fresco de tallo y raíces; contenido de clorofila, y la acumulación de diferentes iones y componentes del rendimiento de trigo. Cuando se aplicaron diferentes niveles de fósforo en plantas de trigo bajo condiciones salinas, el fósforo redujo los efectos de la salinidad. Las aplicaciones de fósforo disminuyeron la absorción de Na+ e incrementaron las concentraciones de potasio, contenidos de clorofila y mejoró el crecimiento de plantas de trigo bajo condiciones salinas y no salinas. Esto indicó que la aplicación de fósforo estabilizó la fisiología de las plantas de trigo, desde que el fósforo activó el transporte de potasio en plantas de trigo. Luego, la aplicación de fósforo tuvo un efecto positivo en el rendimiento de las plantas de trigo. En conclusión, estas investigaciones mostraron que el fósforo indujo la tolerancia a la sal en plantas de trigo.

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Different clays collected from local sources, including Kaolinite, Montmorollinte, Palygorskite and Vermiculite have been utilized for the selective adsorption of sulphur compounds prevailing in petroleum products i.e. crude oil, kerosene and diesel oil. The desulphurization activity of the clay was compared with the charcoal, ion exchange resins and with each other. Desulphurization was performed in batch operation at different time intervals i.e 1, 3 and 6 hrs at 40 ºC temperature. Out of different adsorbents used, Kaoilinte exhibited the maximum desulphurization yield of 60 %, 76 % and 64 % at 6 hrs adsorption incase of crude oil, kerosene and diesel oil respectively. All the mineral clays adsorbents were characterized by surface area, SEM and EDX analysis. The FT-IR study of the desulphurized fractions revealed that mostly high molecular weight thioles and thiophenic compounds were depleted during adsorption process.

The study was conducted to determine the effect of long term use of bovine somatotropic hormone (bST) on days to first oestrus post-partum, number of services per conception, pregnancy rate, lactation length, dry period and calving interval for a period of three years, from 2004 to 2007. Thirty Nili-Ravi lactating buffaloes with approximately similar milk yields and stage of lactation were selected and randomly allocated to two treatments, A and B, with 15 animals in each group. Group A served as control while animals in group B were given injections of bovine somatotropic hormone (250 mg intramuscular per animal) at intervals of 14 days over a period of three years. The calving interval, dry period and lactation length were shorter by 71, 63.9 and 7 days, respectively, in the treated compared with the control group. The days to first oestrus post-partum, service period and services per conception were 160 ± 56.9 vs.98.2 ± 76.4 days, 207.0 ± 85.0 vs. 115.1 ± 107.0 days and 1.47 ± 1.1 vs. 1.31 ± 0.5 in group A vs. B, respectively. Statistically, differences were significant for post-partum oestrous and service period but for services per conception the difference was non-significant. Prevalence of mastitis was significantly higher in the treated animals while differences in body weights of the animals in the groups were not significant.