Resumen (Objetivo) Tryapanosoma cruzi, un agente causal de la enfermedad de Chagas, es un parásito que presenta una alternancia en su ciclo de vida entre un hospedador invertebrado (triatomino) y uno vertebrado (mamífero). Varios estudios han demostrado que en T. cruzi, HSP83 (homólogo de HSP90) es esencial para la división celular y el control de la respuesta al estrés térmico. Esta investigación se concentró en el estudio de la clonación, la caracterización bioinformática y la expresión del gen de la proteína de choque térmico HSP83 de T. cruzi para estudios posteriores sobre señalización. (Metodología) El ARN fue extraído de epimagostigotes T. cruci (clon EPm6/MOHM/VE/2007/ 6c), utilizando un kit comercial. El ADNc que codifica HSP83 se obtuvo utilizando RT-PCR, a partir del ARNm extraído, para lo cual se diseñaron los cebadores con base en la secuencia HSP83 de la cepa T. cruzi CL Brener. La clonación se realizó usando pGEM®T-Easy y se subclonó en el vector de expresión pQE30. Se efectuó la caracterización bioinformática y de secuencias. El gen se expresó y la proteína recombinante se purificó por cromatografía de afinidad, igual que se identificó por inmunotransferencia. (Resultados) El análisis de secuencia mostró similitud con el gen HSP83 de Trypanosoma cruzi y se observaron dominios HSP, así como epítopos B en la secuencia. Después de 3 horas de inducción con IPTG, se obtuvo una proteína recombinante con un peso aproximado de 83 kDa. La reacción de inmunotransferencia con suero hiperinmune anti-epimastigote de T. cruzi permitió la detección de una sola banda con un peso molecular de aproximadamente 83 kDa. (Conclusiones) Todos los resultados indican que se logró la clonación y caracterización de HSP83 de Trypanosoma cruzi.

Resumo (Objetivo) O Tryapanosoma cruzi, agente causador da doença de Chagas, é um parasita que apresenta uma alternância em seu ciclo de vida entre um hospedeiro invertebrado triatomíneo) e um vertebrado(mamífero). Vários estudos demonstraram que, no T. cruzi, a HSP83 (homóloga da HSP90) é essencial para a divisão celular e o controle da resposta ao estresse térmico. Esta pesquisa concentrou-se no estudo da clonagem, caracterização bioinformática e expressão do gene da proteína de choque térmico HSP83 do T. cruzi para estudos adicionais de sinalização. (Metodologia) O RNA foi extraído de epimastigotas de T. cruzi (clone EPm6/MOHM/VE/2007/ 6c) usando um kit comercial. O cDNA que codifica a HSP83 foi obtido por meio de RT-PCR a partir do mRNA extraído, para o qual os primers foram projetados com base na sequência da HSP83 da cepa T. cruzi CL Brener. A clonagem foi realizada com o pGEM®T-Easy e subclonada no vetor de expressão pQE30. Foi realizada a caracterização bioinformática e de sequência. O gene foi expresso e a proteína recombinante foi purificada por cromatografia de afinidade e identificada por imunotransferência. (Resultados) A análise da sequência mostrou similaridade com o gene HSP83 do Trypanosoma cruzi e os domínios HSP, bem como os epítopos B, foram observados na sequência. Após 3 horas de indução com IPTG, foi obtida uma proteína recombinante com peso aproximado de 83 kDa. A imunotransferência com soro hiperimune antiepimastigota de T. cruzi permitiu a detecção de uma única banda com peso molecular de aproximadamente 83 kDa. (Conclusões) Todos os resultados indicam que a clonagem e a caracterização da HSP83 do Trypanosoma cruzi foram alcançadas.

Abstract (Objective) Trypanosoma cruzi, a causal agent of Chagas’ disease, is a parasite whose life cycle alternates between an invertebrate (triatomine) and a vertebrate (mammal) host. Various studies have shown that in T. cruzi, HSP83 (a homolog of HSP90) is essential for cell division and control of the response to thermal stress. This investigation focused on studying the cloning, bioinformatic characterization, and expression of the heat shock protein HSP83 T. cruzi gene for further cell signaling studies. (Methodology) RNA was extracted from T. cruzi epimastigotes (EPm6 clone, MHOM/VE/2007/ 6c) using a commercial kit. The cDNA encoding HSP83 was determined using RT-PCR on extracted mRNA, for which the primers were designed based on the HSP83 sequence of T. cruzi strain CL Brener. Cloning was performed using pGEM®T-Easy and subcloned into the expression vector pQE30. Sequence and bioinformatic characterization were performed. The gene was expressed, and the recombinant protein was purified using affinity chromatography and identified through immunoblotting. (Results) Sequence analysis showed similarity to the gene encoding HSP83 from Trypanosoma cruzi, and HSP domains and B epitopes in the sequence were also observed. After 3 hours of induction with IPTG, a recombinant protein with an approximate weight of 83 kDa was obtained. The immunoblotting reaction with hyperimmune anti-T. cruzi epimastigote serum helped detect a single band with a molecular weight of nearly 83 kDa. (Conclusions) All results indicate that the cloning and characterization of HSP83 from Trypanosoma cruzi was achieved.

Resumen La mastitis bovina es una enfermedad que afecta a las ganaderías de pequeños y medianos productores de los cantones Cayambe y Pedro Moncayo, Provincia de Pichincha-Ecuador. El tratamiento de esta enfermedad resulta complicado debido a la variedad de microorganismos que la provocan. El presente estudio se enfocó en la determinación molecular por medio de reacción en cadena de la polimerasa (PCR) de los agentes etiológicos de la mastitis. Esta técnica presenta múltiples ventajas al reconocer familia, género y especie de microorganismos, y es un método capaz de detectar genes de resistencia de antibióticos, lo que resulta importante al momento de diagnosticar y tratar enfermedades. El objetivo de esta investigación se centró en la identificación de bacterias causantes de la mastitis bovina, utilizando pruebas bioquímicas y moleculares. Las pruebas bioquímicas como tinción Gram, Catalasa, Coagulasa, y Agar Manitol Sal fueron eficientes para obtener cepas puras y determinar el género de algunas bacterias. Se utilizaron primers específicos (RNA16S) para la identificación molecular de 9 agentes etiológicos causantes de la enfermedad en las unidades productivas. Los microorganismos encontrados fueron; Staphylococcus pasteuri, Staphylococcus warneri, Staphylococcus sp., Staphylococcus epidermidis, Staphylococcus aureus, Staphylococcus saprophyticus, Sphingomonas sp., Streptococcus dysgalactiae, Streptococcus uberis, la mayoría presentes en mastitis clínica. Para detectar genes de resistencia se utilizaron primers específicos, de los cuales 7 muestras presentaron el gen para resistencia a blaTEM (β-lactámicos) y 6 muestras presentaron el gen para resistencia a tetA (tetraciclinas). Se identificó multirresistencia en las especies: Staphylococcus pasteuri, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus uberis, Sphingomonas sp.

Abstract Bovine mastitis is a disease that affects the farms of small and medium producers in the cantons of Cayambe and Pedro Moncayo, Pichincha Province-Ecuador. Treating this disease is not easy due to the different microorganisms that cause it. This study focused on the molecular determination by means of polymerase chain reaction (PCR) of the etiological agents of mastitis, having multiple advantages when recognizing family, gender and species of microorganisms. It is a method capable of detecting resistance genes of antibiotics, an important analysis when diagnosing and treating diseases. The aim of this research is to identify bacteria causing bovine mastitis by using biochemical and molecular tests. Biochemical tests such as: Gram staining, Catalase, Coagulase, and Mannitol Salt Agar were efficient to obtain pure strains and determine the gender of some bacteria. Specific primers (RNA16S) were used for the molecular identification of 9 etiological agents causing the disease in the productive units. The microorganisms found were Staphylococcus pasteuri, Staphylococcus warneri, Staphylococcus sp., Staphylococcus epidermidis, Staphylococcus aureus, Staphylococcus saprophyticus, Sphingomonas sp., Streptococcus dysgalactiae, Streptococcus uberis, mostly present in clinic mastitis. To detect resistance genes, specific primers were used, of which 7 samples presented the gene for resistance to blaTEM (β-lactam) and 6 samples presented the gene for resistance to tetA (tetracyclines). Multi-resistance was identified in the species Staphylococcus pasteuri, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus uberis, Sphingomonas sp.

Abstract Introduction: Molecular divergence thresholds have been proposed to distinguish recently separated evolutive units, often displaying more accurate putative species assignments in taxonomic research compared to traditional morphological approaches. This makes DNA barcoding an attractive identification tool for a variety of marine invertebrates, especially for cryptic species complexes. Although GenBank and the Barcode of Life Data System (BOLD) are the major sequence repositories worldwide, very few have tested their performance in the identification of echinoderm sequences. Objective: We use COI echinoderm sequences from local samples and the molecular identification platforms from GenBank and BOLD, in order to test their accuracy and reliability in the DNA barcoding identification for Central American shallow water echinoderms, at genus and species level. Methods: We conducted sampling, tissue extraction, COI amplification, sequencing, and taxonomic identification for 475 specimens. The 348 obtained sequences were individually enquired with BLAST in GenBank as well as using the Identification System (IDS) in BOLD. Query sequences were classified depending on the best match result. McNemar’s chi-squared, Kruskal-Wallis’s and Mann-Whitney’s U tests were performed to prove differences between the results from both databases. Additionally, we recorded an updated list of species reported for the shallow waters of the Central American Pacific. Results: We found 324 echinoderm species reported for Central American Pacific shallow waters. Only 118 and 110 were present in GenBank and BOLD databases respectively. We proposed 325 solved morphology-based identities and 21 provisional identifications in 50 putative taxa. GenBank retrieved 348 molecular-based identifications in 58 species, including twelve provisional identifications in tree taxa. BOLD recovered 170 COI identifications in 23 species with one provisional identification. Nevertheless, 178 sequences retrieved unmatched terms (in 34 morphology-based taxa). Only 86 sequences (25 %) were retrieved as correct identifications and 128 (37 %) as identification errors in both platforms. We include 84 sequences for eleven species not represented in GenBank and 65 sequences for ten species in BOLD Echinoderm COI databases. The identification accuracy using BLAST (175 correct and 152 incorrect identifications) was greater than with IDS engine (110 correct and 218 identification errors), therefore GenBank outperforms BOLD (Kruskal-Wallis = 41.625, df = 1, p < 0.001). Conclusions: Additional echinoderm sample references are needed to improve the utility of the evaluated DNA barcoding identification tools. Identification discordances in both databases may obey specific parameters used in each search algorithm engine and the available sequences. We recommend the use of barcoding as a complementary identification source for Central American Pacific shallow water echinoderm species.

Resumen Introducción: Se han propuesto los umbrales de divergencia molecular para distinguir unidades evolutivas recientemente separadas, que a menudo muestran asignaciones de especies putativas más precisas en la investigación taxonómica en comparación con los enfoques morfológicos tradicionales. Esto hace que los Códigos de Barras de ADN sean una herramienta de identificación atractiva para una variedad de invertebrados marinos, especialmente para complejos de especies crípticas. Aunque GenBank y Barcode of Life Data System (BOLD) son los principales repositorios de secuencias en todo el mundo, muy pocos han probado su desempeño en la identificación de secuencias de equinodermos. Objetivo: Utilizamos secuencias de equinodermos COI de muestras locales y las plataformas de identificación molecular de GenBank y BOLD, para probar su precisión y confiabilidad en la implementación de códigos de barras de ADN para equinodermos de aguas someras de Centroamérica, a nivel de género y especie. Métodos: Realizamos muestreo, extracción de tejido, amplificación de COI, secuenciación e identificación taxonómica de 475 especímenes. Las 348 secuencias obtenidas fueron consultadas individualmente con BLAST en GenBank así como utilizando el Sistema de Identificación (IDS) en BOLD. Las secuencias consultadas se clasificaron según el mejor resultado de coincidencia. Se realizaron las pruebas chi-cuadrado de McNemar, Kruskal-Wallis y U de Mann-Whitney para comprobar diferencias entre los resultados de ambas bases de datos. Además, registramos una lista actualizada de especies reportadas para las aguas someras del Pacífico Centroamericano. Resultados: Encontramos 324 especies de equinodermos reportadas para aguas someras (< 200 m) del Pacífico centroamericano. Sólo 118 y 110 estaban presentes en las bases de datos GenBank y BOLD respectivamente. Propusimos 325 identidades resueltas basadas en morfología y 21 identificaciones provisionales en 50 taxones putativos. GenBank recuperó 348 identificaciones de base molecular en 58 especies, incluidas doce identificaciones provisionales en tres taxones. BOLD recuperó 170 identificaciones de COI en 23 especies con una identificación provisional. Sin embargo, 178 secuencias recuperaron términos no coincidentes (en 34 taxones basados en morfología). Sólo 86 secuencias (25 %) se recuperaron como identificaciones correctas y 128 (37 %) como errores de identificación en ambas plataformas. Incluimos 84 secuencias para once especies no representadas en GenBank y 65 secuencias para diez especies ausentes en las bases de datos BOLD Echinoderm COI. La precisión de la identificación usando BLAST (175 identificaciones correctas y 152 incorrectas) fue mayor que con el motor IDS (110 correctas y 218 errores de identificación), por lo tanto, GenBank supera a BOLD (Kruskal-Wallis = 41.625, df = 1, p < 0.001). Conclusiones: Se necesitan muestras adicionales de equinodermos de referencia para mejorar la utilidad de las herramientas de identificación de códigos de barras de ADN evaluadas. Las discordancias de identificación en ambas bases de datos pueden obedecer a parámetros específicos utilizados en cada algoritmo de búsqueda y a las secuencias disponibles. Recomendamos el uso de códigos de barras como fuente de identificación complementaria para las especies de equinodermos de aguas someras del Pacífico centroamericano.

Abstract Nowadays, fungal contamination of medical Cannabis inflorescences during postharvest has become an increasingly frequent and worrisome problem for consumers and the industry in general. This is because some of these microorganisms can produce secondary metabolites, such as mycotoxins, which can be toxic to humans. To assess the risk posed by fungal contamination and evaluate the potential for fungal isolates to produce mycotoxins, samples of medicinal Cannabis were tested for the presence of mycotoxin-forming fungi. Inflorescences were isolated on PDA agar at 23 ± 2 °C for ten days, and the microorganisms were identified. The strain with morphological characteristics compatible with the genus Aspergillus spp. was selected as the fungus with the highest risk of forming hazardous mycotoxins. This isolate was characterized conventionally and by molecular identification using primers for the internal transcribed spacer region (ITS) of ribosomal DNA and different coding genes and was identified as Aspergillus westerdijkiae. To determine mycotoxin formation, the genome of A. westerdijkiae was sequenced using the Illumina Novaseq platform in South Korea. The antiSMASH tool was used to search for gene clusters associated with producing secondary metabolites, and genes related to toxins were manually curated. Regions where the cluster of genes directly involved in OTA biosynthesis (otaA, otaB, otaC, otaR and otaD) were found, suggesting a potential risk of synthesis of this toxin.

Abstract Jute is classified as a bast fibre crop which is one of the most important natural fibre crops. Jute fibre is both economical and environmentally friendly and it can be utilized for minimizing the use of synthetic fibres. For the quality improvement of jute fibre, the molecular study of the genes linked with the fibre biogenesis is crucial. RNA isolation is a fundamental step for gene expression and transcriptomic studies of jute fibre. RNA isolation is restricted from jute especially from the well-developed bark tissues because it is rich in mucilage, polysaccharides, and phenolic compounds. In this study, a new method was optimized for extracting the total RNA from the field-grown bark tissues of two tossa jute varieties at 30 and 60 Days-After-Germination (DAG). Two-times use of CTAB extraction buffer with SDS and later addition of TRIZOL made the protocol simple, cost effective and minimal time consuming as compared to other methods. The A260/A280 value ranged between 1.99 ± 0.05 to 2.10 ± 0.02 which determined the purity of RNA. The range of the mean yield of the RNA was 232.38 ± 5.01 to 419.49 ± 9.43 µg/ gm of tissue which is abundant for further molecular analysis. For validation of the protocol, the RNA was converted into cDNA which was further amplified by semi quantitative-real-time-PCR using Cellulose synthase gene specific primers. The results indicated that the proposed RNA isolation method will be helpful in further downstream processing for the betterment of jute fibre quality. crops fibres crucial welldeveloped well developed mucilage polysaccharides compounds fieldgrown field grown 3 6 DaysAfterGermination Days After Germination DAG. DAG . (DAG) Twotimes Two times simple methods A260A280 AA A260 A280 A A260/A28 199 1 99 1.9 005 0 05 0.0 210 2 10 2.1 002 02 23238 232 38 232.3 501 5 01 5.0 41949 419 49 419.4 943 9 43 9.4 µg analysis quantitativerealtimePCR quantitative real PCR primers (DAG A260A28 A26 A28 A260/A2 19 1. 00 0. 21 2. 2323 23 232. 50 5. 4194 41 4 419. 94 9. A260A2 A2 A260/A A260A

Abstract The present work was to study the genetic variability between the major carps Labeo rohita and Cirrhinus mrigala and their hybrids of L. rohita (male♂) and C. mrigala (female♀). Genetic variability was studied by employing RAPD molecular markers. 25 samples of each target species having different sizes with the same age group for the determination of interspecific variation were collected. The morphometric parameters such as body weight, total length, tail length, and lengths of dorsal and anal fins of each individual were recorded and results showed that wet body weight, total length, dorsal fin, anal fin, and tail fin length are positively correlated and then the DNA was extracted using the inorganic salt-based method and conformed by Gel electrophoresis. Twenty-four arbitrary decamer primers were used to get species-specific RAPD analysis Distinct and highly reproducible RAPD profiles with significant genetic variability was detected among species. Only five primers showed amplification. The RAPAD primer OPB-05 produced a total of seven bands out of these 5 monomorphic and 2 polymorphic, so in this case, the percentage polymorphism was 28.57%. The Hybrid show more than a 50% difference from the Labeo rohita. This shows that the Hybrid more resembles C.mrigala. Phylogenetic analysis demonstrated that hybrid (L. rohita ♂ X Cirrhinus mrigala ♀) is the closest to C. mrigala and the farthest from L. rohita. Overall data are presented concerning the applications of RAPD markers for hybrid identification, genetic diversity assessment, and studying taxonomic relationships at a molecular level. L male♂ male (male♂ C female♀. female female♀ . (female♀) collected weight saltbased salt based electrophoresis Twentyfour Twenty four speciesspecific specific amplification OPB05 OPB 05 OPB-0 polymorphic case 2857 28 57 28.57% 50 Cmrigala C.mrigala (L ♀ identification assessment level (male (female♀ OPB0 0 OPB- 285 28.57 (female 28.5 28.

Resumo O presente trabalho teve como objetivo estudar a variabilidade genética entre as carpas maiores Labeo rohita e Cirrhinus mrigala e seus híbridos de L. rohita (machos) e C. mrigala (fêmeas). A variabilidade genética foi estudada empregando marcadores moleculares RAPD. 25 amostras de cada espécie-alvo com tamanhos diferentes e com a mesma faixa etária foram coletadas para a determinação da variação interespecífica. Os parâmetros morfométricos como peso corporal, comprimento total, comprimento da cauda e comprimento das nadadeiras dorsal e anal de cada indivíduo foram registrados. O DNA foi extraído através do método à base de sal inorgânico e conformado por eletroforese em gel. 24 primers decâmeros arbitrários foram usados para obter a análise RAPD espécie-específica. Perfis RAPD distintos e altamente reprodutíveis com significativa variabilidade genética foram detectados entre as espécies. Apenas 5 primers apresentaram amplificação. O primer RAPAD OPB-05 produziu um total de 7 bandas, dessas, 5 monomórficas e 2 polimórficas, portanto, neste caso, o percentual de polimorfismo foi de 28,57%. O Hybrid mostrou mais de 50% de diferença do Labeo rohita. Isso mostra que o híbrido se parece mais com o C.mrigala. A análise filogenética demonstrou que o híbrido (L. rohita macho X Cirrhinus mrigala fêmea) é o mais próximo de C. mrigala e o mais distante de L. rohita. Foram apresentados dados relativos à aplicação de marcadores RAPD para identificação de híbridos, avaliação de diversidade genética e estudo de relações taxonômicas ao nível molecular. L machos (machos C fêmeas. fêmeas . (fêmeas) espéciealvo espécie alvo interespecífica corporal registrados gel espécieespecífica. espécieespecífica específica. específica espécie-específica espécies amplificação OPB05 OPB 05 OPB-0 bandas dessas polimórficas portanto caso 2857 28 57 28,57% 50 Cmrigala C.mrigala (L fêmea molecular (fêmeas OPB0 0 OPB- 285 28,57 28,5 28,

ABSTRACT: This study detected Anaplasma marginale in calvesusing blood smears and nested PCR (nPCR) and to compare the results with the clinical signs presented by calves on a dairy farm in the municipality of Castanhal, located northeast of the state Pará (1°07’19.1”S and 47°53’53.0”W), eastern Amazon. To this end, 192 blood samples were collected from 24 animals at 1-20, 21-41 and 42-60 days of age. Blood smears and nPCR with primers for the msp5 gene were performed. The prevalence of A. marginale was 61.5% (118/192) for the blood smear technique and nPCR (msp5). The manifestation of clinical signs of anaplasmosis also increased significantly over the course of the study (P < 0.0001), being lower in animals aged 1-20 days, but increasing among those aged 21-41 and 42-60 days. These signs were characterized by apathy, fever, weight loss, diarrhea, dehydration, and hypochromic mucous membranes. Regarding the evaluation of the diagnostic techniques, no significant difference was observed in the detection of A. marginale between the blood smear and nPCR (P = 0.995), but the agent’s rickets increased on Day 47 (P < 0.01) in both tests, thereby demonstrating a near-linear pattern of increase in rickets over the 60 days, with a consequent decrease in globular volume. This shows that of the 24 animals studied, 21 were infected at some point during the study period. Additionally, there was no significant difference between blood smears and nPCR, probably due to medium and high parasitemia, which were directly related to the clinical signs and decrease in globular volume. ABSTRACT (nPCR Castanhal 1°0719.1S 107191S S 1°07 19.1 1 07 19 47°5353.0W, 4753530W W 47°53 53.0 , 53 0 47°53’53.0”W) Amazon end 2 120, 120 20, 20 2141 41 21-4 4260 42 42-6 age msp performed A 615 61 5 61.5 118/192 118192 118 (118/192 msp5. . (msp5) P 0.0001, 00001 0.0001 0001 0.0001) 1-2 apathy fever loss diarrhea dehydration membranes techniques 0.995, 0995 0.995 995 0.995) agents agent s 4 0.01 001 01 tests nearlinear near linear 6 volume studied period Additionally parasitemia 0719 1S 107 1°0 191 19. 5353 0W 47°5353.0W 4753 47°5 530 53. 47°53’53.0”W 12 214 21- 426 42- 61. 118/19 11819 11 (118/19 (msp5 0000 0.000 000 1- 099 0.99 99 0.0 00 071 10 1° 535 475 47° 118/1 1181 (118/1 (msp 0.00 09 0.9 9 0. 118/ (118/ (118 (11 (1 (

RESUMO: Objetivou-se, na construção deste trabalho, detectar Anaplasma marginale por meio do esfregaço sanguíneo e Nested PCR (nPCR) e comparar os resultados com os sinais clínicos apresentados pelos bezerros em uma propriedade leiteira localizada no município de Castanhal, região nordeste do estado do Pará (1°07’19,1”S e 47°53’53,0”W), Amazônia Oriental. Para isso, foram coletadas 192 amostras sanguíneas de 24 animais, divididos em três períodos: 1-20, 21-41 e 42-60 dias de idade. Foram realizados esfregaços sanguíneos e nPCR com iniciadores para o gene msp5. A prevalência de A. marginale foi de 61,46% (118/192) tanto para a técnica de esfregaço sanguíneo quanto para nPCR (msp5). A manifestação de sinais clínicos da anaplasmose também foi significativamente crescente ao longo do estudo (P < 0,0001), sendo menor em animais de 1 a 20 dias, mas expandindo-se entre os de 21 a 41 dias e 42 a 60 dias, esses sinais foram caracterizados por apatia, febre, perda de peso, diarreia, desidratação e mucosas hipocoradas. Quanto a avaliação das técnicas diagnósticas, não houve diferença significativa entre a detecção de A. marginale no esfregaço sanguíneo e na nPCR (P = 0,995), porém se observou aumento riquetsêmico do agente no 47º dia (P < 0,01) em ambos os testes, demonstrando, assim, um padrão de aumento da riquetsemia próximo ao linear ao longo dos 60 dias, com consequente diminuição do volume globular. Assim, demonstra-se que dos 24 animais estudados, 21 se infectaram em algum momento do período estudado, e não houve diferença significativa entre esfregaço sanguíneo e nPCR, em virtude, provavelmente, das parasitemias médias e altas, as quais estiveram diretamente relacionadas com os sinais clínicos e a diminuição do volume globular. RESUMO Objetivouse, Objetivouse Objetivou se, Objetivou-se trabalho (nPCR Castanhal 1°0719,1S 107191S S 1°07 19,1 07 19 47°5353,0W, 4753530W W 47°53 53,0 , 47 53 0 47°53’53,0”W) Oriental isso 2 períodos 120, 120 20, 1-20 2141 21-4 4260 42-6 idade msp5 msp 6146 61 46 61,46 118/192 118192 118 (118/192 . (msp5) P 0,0001, 00001 0,0001 0001 0,0001) expandindose expandindo 4 6 apatia febre peso diarreia hipocoradas diagnósticas 0,995, 0995 0,995 995 0,995) º 0,01 001 01 testes demonstrando assim globular Assim demonstrase demonstra estudados estudado virtude provavelmente altas 0719 1S 107 1°0 191 19, 5353 0W 47°5353,0W 4753 47°5 530 53, 5 47°53’53,0”W 12 1-2 214 21- 426 42- 614 61,4 118/19 11819 11 (118/19 (msp5 0000 0,000 000 099 0,99 99 0,0 00 071 10 1° 535 475 47° 1- 61, 118/1 1181 (118/1 (msp 0,00 09 0,9 9 0, 118/ (118/ (118 (11 (1 (

Resumo O burro doméstico possui um papel fundamental como animal de tração na economia rural do Paquistão, onde a população desse animal está aumentando a cada ano. A região de controle de mtDNA completa de 40 burros amostrados aleatoriamente foi ampliada por PCR e sequenciada bidirecionalmente por intermédio de primers específicos. Haplótipos distintos de mtDNA obtidos no estudo atual (KY446001 − KY446011) foram submetidos a medidas de haplótipo (h) e diversidade de nucleotídeos (π) por meio de DnaS, bem como análises filogenéticas, de rede e AMOVA. Havia um total de 27 sítios polimórficos presentes em 11 haplótipos de mtDNA exclusivos dos 40 animais estudados de diferentes regiões. A rede de união de vizinhos e a rede de união mediana ilustram a divisão de todos esses haplótipos em duas linhagens núbias e somalis bem definidas, confirmando a origem materna africana do burro doméstico do Paquistão. Os parâmetros de diversidade h (0,967 ± 0,037) e π (0,02917 ± 0,00307) revelaram altos níveis de diversidade genética em burros paquistaneses. AMOVA demonstrou apenas 1% de diferenças genéticas entre as duas linhagens maternas de mtDNA, apontando a falta de subestrutura populacional em burros paquistaneses, como é o caso da população mundial de burros domésticos. Os burros paquistaneses têm origem materna africana e altos níveis de diversidade de mtDNA. A alta diversidade genética pode ser por causa da reprodução não seletiva e de heteroplasmia. Aqui, fornecemos o primeiro relatório sobre a diversidade do mtDNA da região de controle em burros domésticos do Paquistão.

Abstract Domestic donkey plays a key role as a draft animal in rural economy of Pakistan where its population is increasing every year. The complete mtDNA control region of forty randomly sampled donkeys was PCR- amplified and sequenced bi-directionally using specific primers. Distinct mtDNA haplotypes obtained in the current study (KY446001−KY446011) were subjected to haplotype (h) and nucleotide diversity (π) measures using DnaS as well as to phylogenetic, Network, and AMOVA analyses. There were a total 27 polymorphic sites present within 11 unique mtDNA haplotypes from the studied 40 animals from different regions. Neighbor-joining network and median-joining network both illustrated the splitting of all these haplotypes into two well-defined Nubian and Somali lineages, confirming African maternal origin of Pakistani domestic donkey. Diversity parameters h (0.967± 0.037) and π (0.02917± 0.00307) were found to reveal high levels of genetic diversity in Pakistani donkeys. AMOVA demonstrated only 1% of genetic differences between two mtDNA maternal lineages, pointing to lack of population substructure in Pakistani donkeys as is the case with worldwide domestic donkey population. Pakistani donkeys have African maternal origin and high levels of mtDNA diversity. High genetic diversity may be due to non-selective breeding and heteroplasmy. We herein provide the first report on mtDNA diversity of control region in Pakistani domestic donkey.

Resumo A ferrugem da folha, causada por Puccinia triticina, é a ferrugem mais comum do trigo. O fungo é um parasita obrigatório, capaz de produzir urediniósporos infecciosos. Para estudar a estrutura genética da população de ferrugem da folha, 20 primers RAPD foram avaliados em 15 amostras de isolados coletadas no Paquistão. Um total de 105 fragmentos RAPD foram amplificados com uma média de 7 fragmentos por primer. O número de fragmentos amplificados variou de 1 a 12. GL Decamer L-07 e GL Decamer L-01 amplificaram o maior número de bandas (doze), e o primer GL Decamer A-03 amplificou o menor número de bandas, ou seja, um. Os resultados mostraram que quase todos os isolados investigados eram geneticamente diferentes, o que confirma a alta diversidade genética na população de ferrugem da folha. Os esporos de ferrugem podem seguir o padrão de migração em distâncias curtas e longas para áreas vizinhas. Os resultados indicaram que a maior variabilidade foi revelada por 74,9% da diferenciação genética nas populações de ferrugem. Esses resultados sugeriram que cada população não era completamente idêntica e um alto fluxo gênico ocorreu entre a população de ferrugem da folha de diferentes áreas. A maior diferenciação e distância genética entre as populações de ferrugem da folha do Paquistão foram detectadas entre a população de ferrugem da folha no isolado NARC (NARC-4) e AARI-11 e a maior similaridade foi observada entre os isolados NARC (NARC-4) e (NARC-5). O presente estudo mostrou que a população de ferrugem da folha no Paquistão é altamente dinâmica e variável.

Abstract Leaf rust, caused by Puccinia triticina, is the most common rust disease of wheat. The fungus is an obligate parasite capable of producing infectious urediniospores. To study the genetic structure of the leaf rust population 20 RAPD primers were evaluated on 15 isolates samples collected in Pakistan. A total of 105 RAPD fragments were amplified with an average of 7 fragments per primer. The number of amplified fragments varied from 1 to 12. GL Decamer L-07 and GL Decamer L-01 amplified the highest number of bands (twelve) and primer GL Decamer A-03 amplified the lowest number of bands i.e one. Results showed that almost all investigated isolates were genetically different that confirms high genetic diversity within the leaf rust population. Rust spores can follow the migration pattern in short and long distances to neighbor areas. Results indicated that the greatest variability was revealed by 74.9% of genetic differentiation within leaf rust populations. These results suggested that each population was not completely identical and high gene flow has occurred among the leaf rust population of different areas. The highest differentiation and genetic distance among the Pakistani leaf rust populations were detected between the leaf rust population in NARC isolate (NARC-4) and AARI-11and the highest similarity was observed between NARC isolates (NARC-4) and (NARC-5). The present study showed the leaf rust population in Pakistan is highly dynamic and variable.

Abstract Sarcoptic mange or scabies is a contagious parasitic skin disease that affects a wide range of domestic and wildlife species. A cross-sectional study was carried out to determine the prevalence, molecular identification, and characteristics of sarcoptic mange in vicuñas. A total of 3,274 vicuñas were examined. Following ritual harvesting events (“chaccus”) in 13 Andean communities. The presence of mange mites was determined by the skin scraping technique and confirmed by PCR analysis using specific primers for the ITS2 gene of Sarcoptes scabiei. The presence of mange mites was also confirmed by microscopy using samples taken from wallows. A data collection form was used to register the characteristics of the vicuñas sampled. The prevalence of sarcoptic mange was 4.9% (95% CI: 4.1 - 5.6%). All samples from wallows tested positive (9/9). Importantly, the presence of the species S. scabiei was molecularly confirmed. Adult females with regular body condition were more susceptible to sarcoptic mange, although the lesions were mild. This study confirms the presence of S. scabiei in semi-captive vicuñas and points to the possible role of wallows in the dissemination of Sarcoptes mites. crosssectional cross sectional identification 3274 3 274 3,27 examined chaccus (“chaccus” 1 communities ITS sampled 49 4 9 4.9 95% 95 (95 CI 41 4. 5.6%. 56 5.6% . 5 6 5.6%) 9/9. 99 9/9 (9/9) Importantly S mild semicaptive semi captive 327 27 3,2 (“chaccus (9 5.6 9/ (9/9 32 2 3, ( 5. (9/

Resumo A sarna sarcóptica é uma doença parasitária contagiosa da pele que afeta uma ampla gama de espécies domésticas e selvagens. Um estudo transversal foi realizado para determinar a prevalência, identificação molecular e características da sarna sarcóptica em vicunhas. Foram avaliadas 3.274 vicunhas, capturadas durante o "Chaccus", em 13 comunidades rurais alto andinas do Peru. A presença do ácaro da sarna foi determinada pelo raspado de pele e confirmada pela técnica de PCR, com iniciadores específicos para o gene ITS2 de Sarcoptes scabiei e por microscopia nos chafurdeiros. Foi preenchida uma ficha de coleta de dados com as características das vicunhas analisadas. A prevalência de sarna sarcóptica em vicunhas foi de 4,9% (95% IC: 4,1 - 5,6%). Todas as amostras de chafurda testadas (9/9) foram positivas, e a presença de S. scabiei foi confirmada molecularmente. Fêmeas adultas com condições corporais regulares foram mais suscetíveis à sarna sarcóptica, embora as lesões fossem leves. O estudo confirma a presença de S. scabiei em vicunhas em semicativeiro de comunidades camponesas alto andinas do Peru que sofrem de sarna. Destaca-se, ainda, o papel das chafurdas das vicunhas na disseminação da sarna. selvagens 3274 3 274 3.27 Chaccus, Chaccus , "Chaccus" 1 PCR ITS chafurdeiros analisadas 49 4 9 4,9 95% 95 (95 IC 41 4, 5,6%. 56 5,6% . 5 6 5,6%) 9/9 99 (9/9 positivas S molecularmente leves Destacase, Destacase Destaca se, se Destaca-se ainda 327 27 3.2 "Chaccus (9 5,6 9/ (9/ 32 2 3. ( 5,

RESUMO A leishmaniose é um dos mais importantes dilemas de saúde enfrentados pela Organização Mundial da Saúde (OMS) devido à sua ampla disseminação e à grande diversidade de flebotomíneos que a transmitem. Este estudo teve como objetivo detectar a presença de parasitas de Leishmania nos flebotomíneos espalhados em campos de refugiados por meio da técnica PCR-RLFP. Um total de 437 flebotomíneos foi coletado e classificado em duas espécies: Phlebotomus papatasi e Phlebotomus sergenti. O DNA foi extraído das espécies de flebotomíneos das fêmeas e, em seguida, a reação de PCR foi amplificada por dois primers (LITSR, L5.8S) que transcreveram um gene parcial do espaçador transcrito interno (ITS)-1 para o parasita Leishmania com um comprimento de 320 pb. A PCR mostrou a presença de DNA de Leishmania em fêmeas de P. papatasi (10%) e P. sergenti (20%). Para determinar as espécies de Leishmania transmitidas pelas duas espécies de moscas anteriores, a técnica de RFLP-PCR foi realizada pela enzima HaeIII para o DNA de Leishmania extraído delas. A RFLP-PCR mostrou que as fêmeas de P. papatasi transmitiam Leishmania major e as fêmeas de P. sergenti transmitiam Leishmania tropica nos campos de refugiados. Pode-se concluir que a leishmaniose está amplamente distribuída nos campos de refugiados devido à presença de seu vetor. OMS (OMS transmitem PCRRLFP. PCRRLFP RLFP. RLFP PCR-RLFP 43 seguida LITSR, LITSR (LITSR L5.8S L58S LS L5 8S L S ITS1 ITS 1 (ITS)- 32 pb P 10% 10 (10% 20%. 20 20% . (20%) anteriores RFLPPCR RFLP delas Podese Pode se vetor 4 (ITS) 3 (10 2 (20% (ITS (1 (20 ( (2

ABSTRACT Leishmaniasis is one of the most important health dilemmas facing the World Health Organization (WHO), due to it being widespread and the great diversity of sand flies that transmit it. This study aimed to detect the presence of Leishmania parasites in the sand flies spread in Refugee camps by PCR- RLFP technique. A total of 437 sandflies were collected and classified into two species Phlebotomus papatasi and Phlebotomus sergenti. DNA was extracted from the female fly species, then the PCR reaction was amplified by two primers (LITSR, L5.8S) that transcribed a partial internal transcribed spacer (ITS)-1 gene for Leishmania parasite with a length of 320 bp. PCR showed the presence of Leishmania DNA in females of both P. papatasi (10%) and P. sergenti (20%). To determine Leishmania species transmitted by the two previous fly species, the RFLP-PCR technique was performed by the HaeIII enzyme for Leishmania DNA extracted from them. RFLP-PCR showed that P. papatasi females transmitted Leishmania major and P. sergenti females transmitted Leishmania tropica in Refugee camps. It could be concluded that leishmaniasis is widely distributed in Refugee camps due to the presence of its vector. WHO, WHO , (WHO) 43 LITSR, LITSR (LITSR L5.8S L58S LS L5 8S L S ITS1 ITS 1 (ITS)- 32 bp P 10% 10 (10% 20%. 20 20% . (20%) RFLPPCR RFLP them vector (WHO 4 (ITS) 3 (10 2 (20% (ITS (1 (20 ( (2

ABSTRACT Zinnia sp. and hairy beggartick (Bidens pilosa) plants exhibiting symptoms of possible virus infection were found in the municipality of Santa Bárbara d’Oeste, São Paulo State, Brazil. Flexuous filamentous particles and cytoplasmatic inclusions typical of potyvirus infection were observed by transmission electron microscopy, respectively, in leaf extracts and cells of symptomatic leaves. Infection of both plants with bidens mottle virus (BiMoV) was confirmed by RT-PCR using potyvirus universal primers, followed by nucleotide sequencing of the amplicons. The nearly complete genome sequence of the Brazilian isolate, named BiMoV-BR, is 9700 nucleotides long and shares 95.6 % identity with the corresponding nucleotide sequence of a BiMoV isolate from the United States. BiMoV-BR was mechanically transmitted and caused systemic infection on plants of Zinnia sp., hairy beggarstick, sunflower (Helianthus annuus), and lettuce (Lactuca sativa). Myzus persicae transmitted the virus to Zinnia sp. plants with efficacy of 8 % and 42 %, using one and ten aphids per plant, respectively. This is the first detection of BiMoV in Brazil. Further studies are necessary to evaluate the distribution of this potyvirus in the country. sp Bidens pilosa dOeste, dOeste d Oeste, Oeste d’Oeste State Brazil microscopy respectively leaves (BiMoV RTPCR RT PCR primers amplicons BiMoVBR, BiMoVBR BR, BR 970 956 95 6 95. States beggarstick Helianthus annuus, annuus , annuus) Lactuca sativa. sativa . sativa) 4 plant country 97 9

Abstract Mackerel fish (Scomberomorus spp.) represents a significant marine fisheries commodity in Indonesia, characterized by its high commercial value and nutritional content. To understand the intraspecific interactions and genetic variability of Scomberomorus spp., a more extensive research of Scomberomorus spp. populations, including both cultivated and wild specimens, is required. This study aimed to explore the genetic diversity of mackerel fish in Indonesian waters, focusing on the mitochondrial DNA (mtDNA) cytochrome oxidase subunit II (COII) gene, which encodes the second subunit of cytochrome c oxidase (complex IV), is essential for aerobic respiration and energy transformation. Muscle tissue samples from 18 individual mackerel fish collected from various regions in Indonesia, including Palembang, Cilacap, Rembang, Banjarmasin, Ambon, and Fak-Fak Regencies, were utilized. The genomic DNA was isolated and amplified using specific primers: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') and CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Subsequently, the obtained amplicons were subjected to sequencing. The sequence data were then analyzed using the MEGA11 and DnaSP 6 software. Our findings revealed 120 variable sites within the 691 base pairs of mtDNA COII sequences, resulting in a nucleotide diversity (Pi) of 0.07169. Furthermore, we identified eight haplotypes, demonstrating a haplotype diversity (Hd) of 0.8889. Remarkably, all mackerel samples from Palembang and Cilacap clustered into discrete haplotypes, specifically haplotype 1 and haplotype 2, respectively. Our phylogenetic analysis delineated three distinct clades. Clade I, closely related to Scomberomorus cavalla, encompassed all individuals from Ambon, Palembang, Rembang, and one from Banjarmasin. Clade II, associated with Scomberomorus niphonius, included individuals from Cilacap and two from Banjarmasin. Clade III, linked to Scomberomorus semifasciatus, exclusively consisted of individuals from Fak-Fak (Papua). In conclusion, Indonesian waters harbor diverse genetic variations within Scomberomorus spp., and population relationships based on the mtDNA COII gene exhibit notable complexities. Future research endeavors should focus on further elucidating the diversity and relationships among Scomberomorus spp. in diverse Indonesian populations. spp Indonesia content populations specimens required (mtDNA (COII complex IV, IV , IV) transformation Rembang Banjarmasin Ambon FakFak Fak Regencies utilized primers COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Subsequently sequencing MEGA MEGA1 software 12 69 sequences Pi (Pi 007169 0 07169 0.07169 Furthermore haplotypes Hd (Hd 08889 8889 0.8889 Remarkably 2 respectively clades I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusion complexities 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0.0716 0888 888 0.888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0.071 088 88 0.88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0.07 08 8 0.8 (5'-ATGTCACTAAGGGTGGTTGG 00 0.0 0.

Resumo O peixe cavala (Scomberomorus spp.) representa uma importante commodity da pesca marinha na Indonésia, caracterizada pelo seu alto valor comercial e conteúdo nutricional. Para entender as interações intraespecíficas e a variabilidade genética do Scomberomorus spp., é necessária uma pesquisa mais ampla das populações de Scomberomorus spp. Este estudo teve como objetivo explorar a diversidade genética do peixe cavala nas águas da Indonésia, com foco no gene mitocondrial do DNA (mtDNA) da subunidade II da citocromo oxidase (COII) que codifica a segunda subunidade da citocromo c oxidase (complexo IV), essencial para a respiração aeróbica e a transformação de energia. Foram utilizadas amostras de tecido muscular de 18 peixes cavala individuais, coletados de diversas regiões da Indonésia, incluindo Palembang, Cilacap, Rembang, Banjarmasin, Ambon e Regiões de Fak-Fak. O DNA genômico foi isolado e amplificado utilizando iniciadores específicos: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') e CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Posteriormente, os amplicons obtidos foram submetidos a sequenciamento. Os dados de sequência foram então analisados usando o software MEGA 11 e DnaSP 6. Nossos resultados revelaram um total de 120 sítios variáveis dentro dos 691 pares de bases das sequências de mtDNA COII, resultando em uma diversidade de nucleotídeos (Pi) de 0,07169. Além disso, identificamos oito haplótipos distintos, demonstrando uma diversidade haplotípica (Hd) de 0,8889. Notavelmente, todas as amostras de peixe cavala de Palembang e Cilacap se agruparam em haplótipos distintos, especificamente haplótipo 1 e haplótipo 2, respectivamente. Nossa análise filogenética delineou três clados distintos. O Clado I, intimamente relacionado ao Scomberomorus cavalla, englobou todos os indivíduos de Ambon, Palembang, Rembang e um de Banjarmasin. O Clado II, associado ao Scomberomorus niphonius, incluiu indivíduos de Cilacap e dois de Banjarmasin. O Clado III, ligado ao Scomberomorus semifasciatus, consistiu exclusivamente de indivíduos de Fak-Fak (Papua). Em conclusão, as águas indonésias abrigam diversas variações genéticas dentro de Scomberomorus spp., e as relações populacionais com base no gene mtDNA COII apresentam complexidades notáveis. Futuros empreendimentos de pesquisa devem se concentrar em elucidar ainda mais a diversidade e as relações entre as populações de Scomberomorus spp. em diversas regiões da Indonésia. spp Indonésia nutricional (mtDNA (COII complexo IV, IV , IV) energia individuais Banjarmasin FakFak. FakFak Fak Fak. específicos COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Posteriormente sequenciamento 6 12 69 Pi (Pi 007169 0 07169 0,07169 disso distintos Hd (Hd 08889 8889 0,8889 Notavelmente 2 respectivamente I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusão notáveis 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0,0716 0888 888 0,888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0,071 088 88 0,88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0,07 08 8 0,8 (5'-ATGTCACTAAGGGTGGTTGG 00 0,0 0,

Abstract Sharks of the genus Sphyrna are under intense exploitation globally. In Brazil’s northern coast, this genus represents a high proportion of fisheries landings and comprises four species. However, due to difficulty of specific identification when specimens are landed, most of the records are limited to the genus level. Here we analyzed the effectiveness of ITS2 (Internal Transcribed Spacer 2 of rDNA) fragment length protocol (Abercrombie et al., 2005) for identifying hammerhead shark species, comparing with the analysis of COI (Cytochrome oxidase subunit I) and ITS2 sequences. We evaluated samples of muscle tissue acquired in the main fishing ports of Maranhão: Carutapera, Raposa e Tutóia. Sampling was conducted between March 2017 to March 2018 and complemented with material deposited in collection (2015). COI results indicated the occurrence of endangered species which are prohibited to be landed. These include Sphyrna mokarran (67%), S. lewini (15%), S. tudes (3%), and S. tiburo (15%). For the ITS2 marker, we investigated the optimization of the protocol developed by Abercrombie (2005) for to improve the use in this geographical area througout design of a new primers. globally Brazils Brazil s coast However landed level ITS Internal rDNA al al. 2005 Cytochrome I sequences Maranhão Carutapera Tutóia 201 2015. 2015 . (2015) 67%, 67 67% , (67%) S 15%, 15 15% (15%) 3%, 3 3% (3%) 15%. marker (2005 primers 200 20 (2015 6 (67% 1 (15% (3% (200 (201 (67 (15 (3 (20 (6 (1 ( (2

Resumo Os tubarões do gênero Sphyrna estão sob intensa exploração em todo o mundo. No litoral norte do Brasil, esse gênero representa grande proporção dos desembarques pesqueiros e compreende quatro espécies. Porém, devido à dificuldade de identificação específica no momento do desembarque dos espécimes, a maioria dos registros limita-se ao nível do gênero. Aqui analisamos a eficácia do protocolo baseado no comprimento de fragmentos de ITS2 (Abercrombie et al., 2005) para identificar espécies de tubarão-martelo, comparando com a análise das sequências COI e ITS2. Foram avaliadas amostras de tecido muscular adquiridas nos principais portos pesqueiros do Maranhão: Carutapera, Raposa e Tutóia. A amostragem foi realizada entre março de 2017 a março de 2018 e complementada com material depositados em coleção (2015). Os resultados do COI indicaram a ocorrência de espécies ameaçadas cujo desembarque é proibido. Estes incluem Sphyrna mokarran (67%), S. lewini (15%), S. tudes (3%) e S. tiburo (15%). Para o marcador ITS2, investigamos a otimização do protocolo desenvolvido por Abercrombie (2005) para melhorar o uso nesta área geográfica através do desenho de novos primers. mundo Brasil Porém espécimes limitase limita se ITS al al. 2005 tubarãomartelo, tubarãomartelo tubarão martelo, martelo tubarão-martelo Maranhão Carutapera Tutóia 201 2015. 2015 . (2015) proibido 67%, 67 67% , (67%) S 15%, 15 15% (15%) 3% 3 (3% 15%. (2005 primers 200 20 (2015 6 (67% 1 (15% (3 (200 2 (201 (67 (15 ( (20 (6 (1 (2

SUMMARY Mutations in the insulin receptor (INSR) gene may present with variable clinical phenotypes. We report herein a novel heterozygous INSR mutation in an adolescent girl with type A insulin resistance syndrome and her mother. The index case was a 12-year-old girl without obesity who presented with excessive hair growth, especially in the chest and back area, and hyperpigmentation on the back of the neck (acanthosis nigricans). Acanthosis nigricans was first observed at the age of 11 years. On physical examination, the patient had acanthosis nigricans and hypertrichosis with no acne. Systolic and diastolic blood pressure measurement was within the normal range for age and sex. Laboratory tests revealed fasting hyperglycemia, fasting and postprandial hyperinsulinemia, elevated HbA1c level, and biochemical hyperandrogenemia. Fasting plasma lipids were normal. A diagnosis of type A insulin resistance syndrome was considered, and INSR gene mutation analysis was performed. Next-generation sequence analysis was performed with the use of primers containing exon/exon-intron junctions in the INSR gene, and a novel heterozygous c.3486_3503delGAGAAACTGCATGGTCGC/p. Arg1163_Ala1168del change was detected in exon 19 of the INSR gene. In segregation analysis, the same variant was detected in the patient's mother, who had a milder clinical phenotype. We reported a novel, heterozygous, p. Arg1163_Ala1168del mutation in exon 19 of the INSR gene in a patient with type A insulin resistance syndrome, expanding the mutation database. The same mutation was associated with variable phenotypical severity in two subjects within the same family. (INSR phenotypes mother 12yearold yearold 12 year old growth area nigricans. . nigricans) 1 years examination acne sex hyperglycemia hyperinsulinemia HbAc HbA c level hyperandrogenemia considered Nextgeneration Next generation exon/exonintron exonexonintron exon/exon intron c34863503delGAGAAACTGCATGGTCGCp cdelGAGAAACTGCATGGTCGCp 3486 3503delGAGAAACTGCATGGTCGC p delGAGAAACTGCATGGTCGC c.3486_3503delGAGAAACTGCATGGTCGC/p Arg1163Ala1168del ArgAladel Arg1163 Ala1168del Arg Ala del patients s phenotype database family exonintron exonexon delGAGAAACTGCATGGTCGCp 348 Arg116 Aladel 34 Arg11 3 Arg1