Abstract Species of the genus Anisakis (Nematoda: Anisakidae) are indirect life-cycle marine parasites. Planktonic crustaceans serve as first intermediate hosts, while fish and cephalopods as second intermediate or paratenic hosts, and finally the cycle is completed in cetaceans, marine mammals that are the main definitive hosts of the genus. In the life cycle, Anisakis larvae can be ingested by humans as accidental hosts, which can cause anisakiasis, a zoonosis acquired through the consumption of raw or marinated fish and cephalopods. These nematodes have a cosmopolitan distribution; however, their diversity has been poorly studied in the southern hemisphere. Therefore, diversity of Anisakis spp. larvae present in two host species in Chile was evaluated by combining morphometric and genetic analysis. For this purpose, Anisakis spp. larvae were collected from the abdominal cavity of hake Merluccius gayi and the Humboldt squid Dosidicus gigas from fishing ports in the Biobío Region, Chile. Morphometric characterization of Anisakis spp. larvae consisted of measuring the length of the esophagus, esophageal ventricle, tail, total length and maximum body width. The nuclear ITS (ITS1- ITS2) and mitochondrial COX2 molecular regions were used for genetic analysis. Morphometric results revealed that Anisakis larvae extracted from D. gigas were significantly longer than those collected from M. gayi, suggesting high host-dependent phenotypic variability. Molecular and phylogenetic analyses determined the presence of Anisakis pegreffii in both host, however, demonstrated low genetic differentiation and nucleotide diversity among sequences, indicating low genetic variability for the data set. This work constitutes the first molecular record of A. pegreffii in intermediate / paratenic hosts from the coast of Chile.

Resumen Las especies del género Anisakis (Nematoda: Anisakidae) son parásitos marinos con ciclo de vida indirecto. Los crustáceos planctónicos intervienen como primeros hospedadores intermediarios, mientras que peces y cefalópodos intervienen como segundos hospedadores intermediarios o paraténicos, finalmente el ciclo se cierra en los cetáceos, mamíferos marinos que son los principales hospedadores definitivos del género. En el ciclo de vida, las larvas de Anisakis pueden ser ingeridas por el hombre interviniendo como huésped accidental, lo que puede ocasionar anisakiasis, una zoonosis adquirida a través del consumo de peces y cefalópodos crudos o marinados. Estos nemátodos tienen una distribución cosmopolita, sin embargo, su diversidad ha sido escasamente estudiada en el hemisferio Sur. Por tanto, se evaluó la diversidad de las larvas de Anisakis spp., presentes en dos especies de hospederos de Chile, combinando el análisis morfométrico y genético. Para ello, se recolectaron larvas de Anisakis spp. en la cavidad abdominal de la merluza Merluccius gayi y el calamar de Humboldt Dosidicus gigas, procedentes de terminales pesqueros de la región del Biobío, Chile. La caracterización morfométrica de las larvas de Anisakis spp., consistió en la medición de la longitud del esófago, ventrículo esofágico, cola, longitud total y ancho máximo del cuerpo. Para los análisis genéticos se usó la región molecular nuclear ITS (ITS1-ITS2) y mitocondrial COX2. Los resultados morfométricos revelaron que las larvas de Anisakis extraídas de D. gigas fueron significativamente de mayor longitud que las recolectadas en M. gayi, sugiriendo una alta variabilidad fenotípica hospedador-dependiente. Los análisis moleculares y filogenéticos determinaron la presencia de Anisakis pegreffii en ambos hospedadores, sin embargo, demostraron una baja diferenciación genética y diversidad nucleotídica entre las secuencias, indicando una escasa variabilidad genética para el conjunto de datos. Este trabajo constituye el primer registro molecular de A. pegreffii en hospedadores intermediario o paraténicos de la costa de Chile.

Abstract Introduction. During the development of the SARS-CoV-2 pandemic in Antioquia, we experienced epidemiological peaks related to the α, ɣ, β, μ, ƛ, and δ variants. δ had the highest incidence and prevalence. This lineage is of concern due to its clinical manifestations and epidemiological characteristics. A total of 253 δ sublineages have been reported in the PANGOLIN database. The sublineage identification through genomic analysis has made it possible to trace their evolution and propagation. Objective. To characterize the genetic diversity of the different SARS-CoV-2 δ sublineages in Antioquia and to describe its prevalence. Materials and methods. We collected sociodemographic information from 2,675 samples, and obtained 1,115 genomes from the GISAID database between July 12th, 2021, and January 18th, 2022. From the analyzed genomes, 515 were selected because of their high coverage values (>90%) to perform phylogenetic analysis and to infer allele frequencies of mutations of interest. Results. We characterized 24 sublineages. The most prevalent was AY.25. Mutations of interest as L452R, P681R, and P681H were identified in this sublineage, comprising a frequency close to 0.99. Conclusions. This study identified that the AY.25 sublineage has a transmission advantage compared to the other δ sublineages. This attribute may be related to the presence of the L452R and P681R mutations associated in other studies with higher evasion of the immune system and less efficacy of drugs against SARS-CoV-2.

Resumen Introducción. Durante el desarrollo de la pandemia por SARS-CoV-2 en Antioquia se presentaron picos epidemiológicos relacionados con las variantes α, ɣ, β, μ, ƛ y δ, donde δ tuvo la mayor incidencia y prevalencia. Este linaje se considera una variante de preocupación dadas las manifestaciones clínicas que desencadena y sus características epidemiológicas. Se han informado 253 sublinajes δ en la base de datos PANGOLIN. La identificación de estos sublinajes mediante análisis genómico ha permitido rastrear su evolución y propagación. Objetivo. Caracterizar la diversidad genética de los diferentes sublinajes δ de SARSCoV-2 en Antioquia y determinar su prevalencia. Materiales y métodos. Se recopiló información sociodemográfica de 2.675 muestras y de 1.115 genomas del repositorio GISAID entre el 12 de julio de 2021 y el 18 de enero de 2022. Se seleccionaron 501 por su alto porcentaje de cobertura (>90 %) para realizar análisis filogenéticos e inferencia de frecuencias alélicas de mutaciones de interés. Resultados. Se caracterizaron 24 sublinajes donde el más prevalente fue AY.25. En este sublinaje se identificaron mutaciones de interés como L452R, P681R y P681H, que comprendían una frecuencia cercana a 0,99. Conclusiones. Este estudio permitió identificar que el sublinaje AY.25 tiene una ventaja de transmisión en comparación con los otros sublinajes δ. Esto puede estar relacionado con la presencia de las mutaciones L452R y P681R que en otros estudios se han visto asociadas con una mayor transmisibilidad, evasión del sistema inmunitario y menor eficacia de los medicamentos contra SARS-CoV-2.

Resumen El maíz (Zea mays L.) es uno de los cultivos más sembrados en el mundo, siendo Argentina líder mundial en producción y exportación. La Provincia de Santiago del Estero, el este de Tucumán y el norte de Córdoba abarcan ocho zonas agroclimáticas en la región Chaco semiárida, la cual se caracteriza por un amplio rango de temperatura y frecuentes sequías que exponen al cultivo a patógenos, particularmente Aspergillus flavus, responsable de la podredumbre de la espiga y la contaminación de granos con micotoxinas como aflatoxina B1 y ácido ciclopiazónico. Se obtuvieron aislados del hongo desde espigas de maíz y se caracterizaron según capacidad toxigénica y morfotipos de esclerocios (S < 400 μm, asociados con elevados niveles de aflatoxinas y L > 400 μm, relacionados con niveles variables de aflatoxinas). Además, aquellos que no producían aflatoxinas se estudiaron para determinar sus relaciones filogenéticas sobre la base de un segmento del gen CaM. Cincuenta y ocho aislados fueron obtenidos en ocho localidades representativa de cada zona agroclimática, 30 de los cuales resultaron no aflatoxigénicos, 28 aflatoxigénicos y todos productores de ácido ciclopiazónico. Seis aislados no produjeron esclerocios, 51 fueron L y solo uno fue S, siendo este último no aflatoxigénico. El número de esclerocios correlacionó positivamente con la producción de aflatoxina B1, mientras que el tamaño lo hizo de manera negativa. Las secuencias del gen CaM corroboraron que los aislados pertenecen al clado A. flavus y la alta similitud nucleotídica (99,4% a 100%) reveló casi nula diversidad genética en esta región. No se observaron diferencias en la proporción de aislados entre campañas agrícolas estudiadas ni distritos agroclimáticos. Esta investigación reveló características de las poblaciones de hongos en esta región agrícola del norte argentino.

Abstract Maize (Zea mays L.) is one of the most widely planted crops globally with Argentina leading world production and exportation. Santiago del Estero province, east of Tucumán and north of Córdoba encompasses eight agro-climatic zones in the Chaco Semi-arid region, agro-ecologically characterized by a wide temperature range and frequent drought periods that expose the crop to pathogens, particularly Aspergillus flavus. This pathogen is responsible for ear rot and grain contamination with mycotoxins such as aflatoxin B1 and cyclopiazonic acid. This study obtained fungal isolates from ears of maize and characterized them according to toxigenic capability and morphotype of sclerotia (S < 400 μm, associated with high levels of aflatoxins and L > 400 μm, related to variable levels of aflatoxins). In addition, those not producing aflatoxins were studied to determine phylogenetic relationships based on sequences of a segment of the CaM gene. Fifty-eight isolates were obtained in eight localities representing each agro-climatic zone, 30 of which were non-aflatoxigenic, 28 aflatoxigenic, and all producers of ciclopiazonic acid. Six isolates did not produce sclerotia, 51 were L and only one was S, the latter being a non-producer of aflatoxins. The number of sclerotia was positively correlated with the production of aflatoxin B1, while size was negatively correlated. The CaM gene sequences corroborated that the isolates belonged to the A. flavus clade and the high nucleotide similarity among them (99.4% to 100%) revealed almost zero genetic diversity in this geographic region. No significant differences were observed in the proportion of isolates between growing seasons or among agroclimatic districts. This research revealed characteristics of fungus populations in this agricultural region of north Argentina.

Abstract Mackerel fish (Scomberomorus spp.) represents a significant marine fisheries commodity in Indonesia, characterized by its high commercial value and nutritional content. To understand the intraspecific interactions and genetic variability of Scomberomorus spp., a more extensive research of Scomberomorus spp. populations, including both cultivated and wild specimens, is required. This study aimed to explore the genetic diversity of mackerel fish in Indonesian waters, focusing on the mitochondrial DNA (mtDNA) cytochrome oxidase subunit II (COII) gene, which encodes the second subunit of cytochrome c oxidase (complex IV), is essential for aerobic respiration and energy transformation. Muscle tissue samples from 18 individual mackerel fish collected from various regions in Indonesia, including Palembang, Cilacap, Rembang, Banjarmasin, Ambon, and Fak-Fak Regencies, were utilized. The genomic DNA was isolated and amplified using specific primers: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') and CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Subsequently, the obtained amplicons were subjected to sequencing. The sequence data were then analyzed using the MEGA11 and DnaSP 6 software. Our findings revealed 120 variable sites within the 691 base pairs of mtDNA COII sequences, resulting in a nucleotide diversity (Pi) of 0.07169. Furthermore, we identified eight haplotypes, demonstrating a haplotype diversity (Hd) of 0.8889. Remarkably, all mackerel samples from Palembang and Cilacap clustered into discrete haplotypes, specifically haplotype 1 and haplotype 2, respectively. Our phylogenetic analysis delineated three distinct clades. Clade I, closely related to Scomberomorus cavalla, encompassed all individuals from Ambon, Palembang, Rembang, and one from Banjarmasin. Clade II, associated with Scomberomorus niphonius, included individuals from Cilacap and two from Banjarmasin. Clade III, linked to Scomberomorus semifasciatus, exclusively consisted of individuals from Fak-Fak (Papua). In conclusion, Indonesian waters harbor diverse genetic variations within Scomberomorus spp., and population relationships based on the mtDNA COII gene exhibit notable complexities. Future research endeavors should focus on further elucidating the diversity and relationships among Scomberomorus spp. in diverse Indonesian populations. spp Indonesia content populations specimens required (mtDNA (COII complex IV, IV , IV) transformation Rembang Banjarmasin Ambon FakFak Fak Regencies utilized primers COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Subsequently sequencing MEGA MEGA1 software 12 69 sequences Pi (Pi 007169 0 07169 0.07169 Furthermore haplotypes Hd (Hd 08889 8889 0.8889 Remarkably 2 respectively clades I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusion complexities 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0.0716 0888 888 0.888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0.071 088 88 0.88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0.07 08 8 0.8 (5'-ATGTCACTAAGGGTGGTTGG 00 0.0 0.

Resumo O peixe cavala (Scomberomorus spp.) representa uma importante commodity da pesca marinha na Indonésia, caracterizada pelo seu alto valor comercial e conteúdo nutricional. Para entender as interações intraespecíficas e a variabilidade genética do Scomberomorus spp., é necessária uma pesquisa mais ampla das populações de Scomberomorus spp. Este estudo teve como objetivo explorar a diversidade genética do peixe cavala nas águas da Indonésia, com foco no gene mitocondrial do DNA (mtDNA) da subunidade II da citocromo oxidase (COII) que codifica a segunda subunidade da citocromo c oxidase (complexo IV), essencial para a respiração aeróbica e a transformação de energia. Foram utilizadas amostras de tecido muscular de 18 peixes cavala individuais, coletados de diversas regiões da Indonésia, incluindo Palembang, Cilacap, Rembang, Banjarmasin, Ambon e Regiões de Fak-Fak. O DNA genômico foi isolado e amplificado utilizando iniciadores específicos: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') e CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Posteriormente, os amplicons obtidos foram submetidos a sequenciamento. Os dados de sequência foram então analisados usando o software MEGA 11 e DnaSP 6. Nossos resultados revelaram um total de 120 sítios variáveis dentro dos 691 pares de bases das sequências de mtDNA COII, resultando em uma diversidade de nucleotídeos (Pi) de 0,07169. Além disso, identificamos oito haplótipos distintos, demonstrando uma diversidade haplotípica (Hd) de 0,8889. Notavelmente, todas as amostras de peixe cavala de Palembang e Cilacap se agruparam em haplótipos distintos, especificamente haplótipo 1 e haplótipo 2, respectivamente. Nossa análise filogenética delineou três clados distintos. O Clado I, intimamente relacionado ao Scomberomorus cavalla, englobou todos os indivíduos de Ambon, Palembang, Rembang e um de Banjarmasin. O Clado II, associado ao Scomberomorus niphonius, incluiu indivíduos de Cilacap e dois de Banjarmasin. O Clado III, ligado ao Scomberomorus semifasciatus, consistiu exclusivamente de indivíduos de Fak-Fak (Papua). Em conclusão, as águas indonésias abrigam diversas variações genéticas dentro de Scomberomorus spp., e as relações populacionais com base no gene mtDNA COII apresentam complexidades notáveis. Futuros empreendimentos de pesquisa devem se concentrar em elucidar ainda mais a diversidade e as relações entre as populações de Scomberomorus spp. em diversas regiões da Indonésia. spp Indonésia nutricional (mtDNA (COII complexo IV, IV , IV) energia individuais Banjarmasin FakFak. FakFak Fak Fak. específicos COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Posteriormente sequenciamento 6 12 69 Pi (Pi 007169 0 07169 0,07169 disso distintos Hd (Hd 08889 8889 0,8889 Notavelmente 2 respectivamente I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusão notáveis 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0,0716 0888 888 0,888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0,071 088 88 0,88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0,07 08 8 0,8 (5'-ATGTCACTAAGGGTGGTTGG 00 0,0 0,

Resumo O gene do hormônio de crescimento (GH) desempenha um papel vital na regulação do metabolismo animal e do tamanho corporal, tornando-se um potencial candidato para influenciar o desempenho do gado. Este estudo teve como objetivo investigar os polimorfismos dentro do gene GH e suas associações com 10 características biométricas na população de gado Sumbawa da Indonésia. Dados de características biométricas e amostras de sangue foram coletados de 112 indivíduos de gado Sumbawa, e suas sequências genéticas do gene GH foram analisadas usando dois conjuntos de primers para amplificação. Sete polimorfismos de nucleotídeo único (SNPs) foram identificados no gene GH: g.442C>T, g.446G>C, g.558C>T, g.649C>A, g.1492C>A, g.1510C>A e g.1578G>A. Todos os SNPs estavam localizados na região intrônica, exceto o SNP g.558C>T, que foi encontrado na região da sequência de codificação (CDS). O SNP g.558C>T é classificado como uma variante sinônima. A análise de haplótipos revelou um forte desequilíbrio de ligação entre os SNPs g.558C>T e g.649C>A. As distribuições de genótipos e alelos de todos os SNPs estavam de acordo com o equilíbrio de Hardy-Weinberg (p > 0,05, χ2 < 15,56), exceto para os SNPs g.446G>C e g.1492C>A. O estudo de associação mostrou que o SNP g.442C>T afetou significativamente (p < 0,05) as características HL, BL, SH e PH no gado Sumbawa. Além disso, o g.446G>C e o g.558C>T também foram encontrados associados às características PH e CC, respectivamente. Os polimorfismos detectados no gene GH podem ter implicações para programas de seleção visando melhorar as características biométricas desejadas no gado Sumbawa. A melhoria da produtividade pecuária pode ser feita através da compreensão da diversidade genética e sua relação com as características fenotípicas. (GH corporal tornandose tornando se 1 Indonésia 11 amplificação (SNPs g442CT gCT g 442C T C g446GC gGC 446G G g558CT 558C g649CA gCA 649C g.649C>A g1492CA 1492C g.1492C>A g1510CA 1510C g1578GA gGA 1578G g.1578G>A intrônica CDS. CDS . (CDS) sinônima HardyWeinberg Hardy Weinberg p 005 0 05 0,05 χ 15,56, 1556 15,56 , 15 56 15,56) HL BL disso CC respectivamente fenotípicas CT GC CA GA (CDS 00 0,0 155 15,5 5 0, 15,

Abstract The growth hormone (GH) gene plays a vital role in regulating animal metabolism and body size, making it a potential candidate for influencing livestock performance. This study aimed to investigate the polymorphisms within the GH gene and their associations with 10 biometric traits in the Sumbawa cattle population of Indonesia. Biometric trait data and blood samples were collected from 112 Sumbawa cattle individuals, and their GH gene sequences were analyzed using two sets of primers for amplification. Seven single nucleotide polymorphisms (SNPs) were identified in the GH gene: g.442C>T, g.446G>C, g.558C>T, g.649C>A, g.1492C>A, g.1510C>A, and g.1578G>A. All SNPs were located in the intronic region except for SNP g.558C>T, which was found in the coding sequence (CDS) region. The SNP g.558C>T is classified as a synonymous variant. Haplotype analysis revealed a strong linkage disequilibrium between SNPs g.558C>T and g.649C>A. Distributions of genotypes and alleles of all SNPs were in agreement with the Hardy-Weinberg equilibrium (p > 0.05, χ2 < 15.56), except for SNPs g.446G>C and g.1492C>A. The association study showed that the SNP g.442C>T significantly (p < 0.05) affected HL, BL, SH, and PH traits in Sumbawa cattle. Additionally, the g.446G>C and g.558C>T were also found to be associated with PH and CC traits, respectively. The polymorphisms detected in the GH gene could have implications for selection programs to enhance desired biometric traits in Sumbawa cattle. Improving livestock productivity can be done by understanding genetic diversity and its relationship with phenotypic characteristics. (GH size performance 1 Indonesia 11 individuals amplification (SNPs g442CT gCT g 442C T C g446GC gGC 446G G g558CT 558C g649CA gCA 649C A g.649C>A g1492CA 1492C g.1492C>A g1510CA 1510C g.1510C>A g1578GA gGA 1578G g.1578G>A CDS (CDS variant HardyWeinberg Hardy Weinberg p 005 0 05 0.05 χ 15.56, 1556 15.56 , 15 56 15.56) HL BL SH Additionally respectively characteristics CT GC CA GA 00 0.0 155 15.5 5 0. 15.

Resumo O burro doméstico possui um papel fundamental como animal de tração na economia rural do Paquistão, onde a população desse animal está aumentando a cada ano. A região de controle de mtDNA completa de 40 burros amostrados aleatoriamente foi ampliada por PCR e sequenciada bidirecionalmente por intermédio de primers específicos. Haplótipos distintos de mtDNA obtidos no estudo atual (KY446001 − KY446011) foram submetidos a medidas de haplótipo (h) e diversidade de nucleotídeos (π) por meio de DnaS, bem como análises filogenéticas, de rede e AMOVA. Havia um total de 27 sítios polimórficos presentes em 11 haplótipos de mtDNA exclusivos dos 40 animais estudados de diferentes regiões. A rede de união de vizinhos e a rede de união mediana ilustram a divisão de todos esses haplótipos em duas linhagens núbias e somalis bem definidas, confirmando a origem materna africana do burro doméstico do Paquistão. Os parâmetros de diversidade h (0,967 ± 0,037) e π (0,02917 ± 0,00307) revelaram altos níveis de diversidade genética em burros paquistaneses. AMOVA demonstrou apenas 1% de diferenças genéticas entre as duas linhagens maternas de mtDNA, apontando a falta de subestrutura populacional em burros paquistaneses, como é o caso da população mundial de burros domésticos. Os burros paquistaneses têm origem materna africana e altos níveis de diversidade de mtDNA. A alta diversidade genética pode ser por causa da reprodução não seletiva e de heteroplasmia. Aqui, fornecemos o primeiro relatório sobre a diversidade do mtDNA da região de controle em burros domésticos do Paquistão.

Abstract Domestic donkey plays a key role as a draft animal in rural economy of Pakistan where its population is increasing every year. The complete mtDNA control region of forty randomly sampled donkeys was PCR- amplified and sequenced bi-directionally using specific primers. Distinct mtDNA haplotypes obtained in the current study (KY446001−KY446011) were subjected to haplotype (h) and nucleotide diversity (π) measures using DnaS as well as to phylogenetic, Network, and AMOVA analyses. There were a total 27 polymorphic sites present within 11 unique mtDNA haplotypes from the studied 40 animals from different regions. Neighbor-joining network and median-joining network both illustrated the splitting of all these haplotypes into two well-defined Nubian and Somali lineages, confirming African maternal origin of Pakistani domestic donkey. Diversity parameters h (0.967± 0.037) and π (0.02917± 0.00307) were found to reveal high levels of genetic diversity in Pakistani donkeys. AMOVA demonstrated only 1% of genetic differences between two mtDNA maternal lineages, pointing to lack of population substructure in Pakistani donkeys as is the case with worldwide domestic donkey population. Pakistani donkeys have African maternal origin and high levels of mtDNA diversity. High genetic diversity may be due to non-selective breeding and heteroplasmy. We herein provide the first report on mtDNA diversity of control region in Pakistani domestic donkey.

Abstract Genomic effect variants associated with survival and protection against complex diseases vary between populations due to microevolutionary processes. The aim of this study was to analyse diversity and distribution of effect variants in a context of potential positive selection. In total, 475 individuals of Lithuanian origin were genotyped using high-throughput scanning and/or sequencing technologies. Allele frequency analysis for the pre-selected effect variants was performed using the catalogue of single nucleotide polymorphisms. Comparison of the pre-selected effect variants with variants in primate species was carried out to ascertain which allele was derived and potentially of protective nature. Recent positive selection analysis was performed to verify this protective effect. Four variants having significantly different frequencies compared to European populations were identified while two other variants reached borderline significance. Effect variant in SLC30A8 gene may potentially protect against type 2 diabetes. The existing paradox of high rates of type 2 diabetes in the Lithuanian population and the relatively high frequencies of potentially protective genome variants against it indicate a lack of knowledge about the interactions between environmental factors, regulatory regions, and other genome variation. Identification of effect variants is a step towards better understanding of the microevolutionary processes, etiopathogenetic mechanisms, and personalised medicine. processes total 47 highthroughput throughput andor or technologies preselected pre selected polymorphisms nature significance SLCA SLC A SLC30A factors regions variation mechanisms medicine 4

Abstract Indian mustard (Brassica juncea) is an important contributor towards edible oil supply in India. Traditional Indian mustard varieties contain high proportion of 18C polyunsaturated fatty acids (linoleic and linolenic acids) and large amounts of long-chain monounsaturated FAs, mainly erucic acid, in seeds. Oleate desaturase (FAD2) regulates the composition of 18C PUFAs in cellular membranes and TAG in seed oil. The present study was conducted to gain insight into the allelic diversity of the FAD2 gene in Indian mustard. Analyses of cloned FAD2 genes of three Indian mustard varieties revealed a novel FAD2 gene that has a longer ORF (1167 bp) owing to insertions and several SNPs across its length that distinguish it from the more prevalent native FAD2 gene. Overall, the Indian mustard varieties possess three FAD2 alleles, but there is limited nucleotide diversity among members of each FAD2 type across varieties, suggesting narrow genetic diversity among the varieties examined. Brassica juncea India C linoleic longchain long chain FAs acid seeds FAD (FAD2 1167 (116 bp Overall alleles examined (FAD 116 (11 11 (1 1 (

Abstract Dicliptera tinctoria is a member of Acanthaceae, which has a wide distribution and contains potentially medicinal species, and exhibited pharmaceutical potentials. This study sequenced and characterized the complete chloroplast genome of Dicliptera tinctoria. The newly sequenced cpDNA of D. tinctoria was 150,733 bp in length and had a typical quadripartite structure consisting of a large single copy (LSC, 82,895 bp), a small single copy (SSC, 17,249 bp), and two inverted repeat (IRs, 25,295 bp each) regions. This genome also contained 80 protein-coding genes, 30 transfer RNAs, and four ribosomal RNAs, which is identical to other chloroplast genomes in Acanthaceae family. Nucleotides diversity analysis among chloroplast genomes of Acanthaceae species revealed eight hypervariable regions, including trnK_UUU-matK, trnC_GCA-petN, accD, rps12-clpP, rps3-rps19, ycf1-ndhF, ccsA-ndhD, and ycf1. Phylogenetic analysis revealed the paraphyly of Dicliptera species and monophyly in four Acanthaceae subfamilies. These results provide an overview of genomic variations in Acanthaceae chloroplast genome, which is helpful for further genomic studies. potentials D 150733 150 733 150,73 LSC, LSC (LSC 82895 82 895 82,89 bp, , bp) SSC, SSC (SSC 17249 17 249 17,24 IRs, IRs (IRs 25295 25 295 25,29 each regions 8 proteincoding protein coding genes 3 RNAs family trnK_UUUmatK, trnKUUUmatK trnK_UUU matK, trnK UUU matK trnK_UUU-matK trnC_GCApetN, trnCGCApetN trnC_GCA petN, trnC GCA petN trnC_GCA-petN accD rps12clpP, rps12clpP rpsclpP rps12 clpP, clpP rps rps12-clpP rps3rps19, rps3rps19 rpsrps rps3 rps19, rps19 rps3-rps19 ycf1ndhF, ycf1ndhF ycfndhF ycf1 ndhF, ndhF ycf ycf1-ndhF ccsAndhD, ccsAndhD ccsA ndhD, ndhD ccsA-ndhD subfamilies studies 15073 15 73 150,7 8289 89 82,8 1724 1 24 17,2 2529 2 29 25,2 UUUmatK trnK_UUUmatK trnKUUU GCApetN trnC_GCApetN trnCGCA rps1 rps3rps1 rps3-rps1 1507 7 150, 828 82, 172 17, 252 25, rps3rps rps3-rps

ABSTRACT Peru holds a high mammalian diversity in its Amazonian region, with 326 species. However, our knowledge about the actual diversity is still considered incomplete, and the molecular information for those species in genetic databases is even less comprehensive. To assess the availability of genetic information for Peruvian Amazonian mammals relative to known diversity, we surveyed the Amazonian mammals with at least one molecular marker in the most widely used repositories for nucleotide sequences, GenBank and BOLD Systems. Our survey focused on widely used molecular markers in evolutionary biology-cytochrome b [cyt-b], cytochrome oxidase I [COI], 12S ribosomal RNA [12S], and the mitogenome [mit]-derived from Peruvian Amazon mammals. Additionally, to gain insights into the current mammalian sampling effort in Peruvian Amazonia, we generated a map of unique sampling localities and a heat map, utilizing 41951 records, which identified six major information gaps. This comprehensive analysis found 1597 genetic sequences corresponding to 180 mammalian species (55.2% of Peruvian Amazonian species): COI (38 species), cyt-b (167 species), 12S (56 species), and mitogenome (16 species). Taxonomically, Rodentia (53 species, four markers), Chiroptera (63 species, three markers), and Didelphimorphia (27 species, four markers) represented most molecular data, with a concentration of molecular markers in the orders Chiroptera (703) and Rodentia (499). Geographically, the Loreto department has the largest genetic information (530 records, 99 species). These results confirm a worrying underrepresentation of Peruvian Amazonian diversity in molecular databases. Consequently, we advocate for the use of scientific collections as an alternative source to systematically generate genetic information for the Amazonian mammal diversity in Peru to compensate for the current underrepresentation. region 32 However incomplete Systems biologycytochrome biology cytb, cytb cyt , [cyt-b] COI, [COI] S 12S, [12S] mitderived mit derived Additionally Amazonia 4195 records gaps 159 18 55.2% 552 55 2 (55.2 species) 38 (3 167 56 (5 16 (1 . Taxonomically 53 markers, 63 (6 27 (2 data 703 (703 499. 499 (499) Geographically 530 9 Consequently 3 [cyt-b [COI [12S 419 15 1 55.2 5 (55. ( 6 70 (70 49 (499 41 55. (55 7 (7 4 (49 (4

ABSTRACT The human X-chromosome non-coding markers, such as short tandem repeats (STRs), single nucleotide polymorphisms (SNPs), insertion-deletions (INDELs) and Alu insertions, are useful for revealing relationships among populations and for the identification of individuals. In the last decades, a number of studies have been performed to determine the genetic structure of Latin American populations by using X-chromosome markers. These studies provided useful information regarding the genetic composition of these populations and their relationship with Native American, Asian and European populations. One of the most interesting findings achieved by X-chromosome studies is the bias in the sex ratio of individuals that gave rise to the current Latin American populations, as it was previously observed through the analysis of uniparental markers, and which is undoubtedly evidenced in the differential inheritance of X-chromosome in comparison to autosomes. Besides, the genetic drift process that affected Native American populations is more pronounced in X-chromosome markers than in autosomes. The present review summarizes our current knowledge concerning X-chromosome non-coding polymorphisms studied in Latin American populations.

RESUMEN Los marcadores no codificantes del cromosoma X humano, como las repeticiones cortas en tándem (STR), los polimorfismos de un solo nucleótido (SNP), las inserciones-deleciones (INDEL) y las inserciones Alu, son útiles para revelar la relación existente entre poblaciones, y también para la identificación de personas. En las últimas décadas, se han realizado una serie de estudios para determinar la estructura genética de las poblaciones latinoamericanas, utilizando marcadores de cromosoma X. Estos estudios proporcionaron información útil sobre la composición genética de estas poblaciones y su relación con las poblaciones nativas americanas, asiáticas y europeas. Uno de los hallazgos más interesantes logrados en estos estudios es el sesgo en la proporción de sexos de los individuos que originaron las poblaciones latinoamericanas actuales, tal como se observó previamente a través del análisis de marcadores uniparentales, y que queda evidenciado por la herencia diferencial del cromosoma X en comparación con los autosomas. Además, el proceso de deriva genética que afectó a las poblaciones nativas americanas actuó de manera más pronunciada en los marcadores del cromosoma X que en los autosomas. La presente revisión resume nuestro conocimiento actual sobre los polimorfismos no codificantes del cromosoma X estudiados en poblaciones latinoamericanas.

Resumo Isla Arena está localizada na coordenada 20°70’N - 90°45’W, de Campeche, México. Nesses estuários, o oceano se mistura com a água doce e os ecossistemas se concentram onde proliferam petenos e flamingos rosa. Crustáceos e moluscos abundam no mar. Apesar de sua enorme riqueza marinha, não há estudos realizados sobre a presença de microrganismos halofílicos nessas águas. Neste trabalho, a diversidade e estrutura da comunidade microbiana foram investigadas através de uma abordagem metagenômica e corroboradas para o sequenciamento de genes 16S rRNA. Verificou-se que o filo Fimicutes predomina com mais de 50%, quase na mesma proporção da classe Bacilli e com quase 41% de abundância relativa da ordem Bacillales. Os resultados do sequenciamento mostraram que uma das amostras apresentou alto percentual de similaridade (99,75%) pelo programa Nucleotide BLAST com um microrganismo peculiar: Bacillus subtilis. Nossos resultados demonstram que B. subtilis pode ser uma fonte eficiente de proteases, lipases e celulases, provenientes de comunidades microbianas halofílicas localizadas em áreas pouco exploradas.

Abstract Isla Arena is located in the coordinate 20° 70´ N - 90° 45´ W, from Campeche, Mexico. In these estuaries, the ocean mixes with fresh water, and ecosystems are concentrated where petenes and pink flamingos proliferate. Crustaceans and mollusks abound in the sea. Despite its enormous marine wealth, there are no studies carried out on which halophilic microorganisms are present in these waters. In this work, the diversity and structure of the microbial community was investigated through a metagenomics approach and corroborated for sequencing of 16S rRNA genes. It was found that the phylum Fimicutes predominates with more than 50%, in almost the same proportion of the class Bacilli and with almost 41% of relative abundance of the order Bacillales. The sequencing results showed that one of the samples presented a high percentage of similarity (99.75%) using the Nucleotide BLAST program with a peculiar microorganism: Bacillus subtilis. This microorganism is one of the best characterized bacteria among the gram-positive ones. Our results demonstrate that B. subtilis can be an efficient source of proteases, lipases and cellulases, from halophilic microbial communities located in poorly explored areas.

Resumo Cucumber mosaic cucumovirus (CMV) é uma tremenda ameaça aos vegetais em todo o mundo, inclusive no Paquistão. O presente trabalho foi conduzido para investigar a variabilidade genética de isolados de CMV infectando vegetais de ervilha e espinafre na região de Pothwar, Paquistão. Pesquisas com base em sorologia durante 2016-2017 revelaram 31,70% da incidência geral da doença por CMV em safras de ervilha e espinafre. O ensaio de imunoabsorção enzimática em sanduíche de anticorpo triplo (TAS-ELISA) revelou que todos os isolados positivos pertencem ao subgrupo II do CMV. Dois cDNA selecionados de amostras positivas para ELISA representando cada safra de ervilha e espinafre foram amplificados por PCR (ca.1100 pb) e sequenciados correspondendo ao gene CMV CP que compartilhou 93,7% de identidade de nucleotídeo um com o outro. Ambas as sequências de isolados de ervilha CMV (AAHAP) e espinafre (AARS) do Paquistão foram submetidas ao GenBank como nos de acesso. MH119071 e MH119073, respectivamente. A análise BLAST revelou 93,4% de identidade de sequência do isolado AAHAP com SpK (KC763473) do Irã, enquanto o isolado AARS compartilhou a identidade máxima (94,5%) com a cepa 241 (AJ585519) da Austrália e agrupada com alguns isolados de referência do subgrupo II de CMV do Reino Unido (Z12818) e EUA (AF127976) em uma reconstrução filogenética vizinha. Um total de 59 sítios polimórficos (segregantes) (S) com diversidade de nucleotídeos (π) de 0,06218 foi evidente, enquanto nenhum evento INDEL foi observado em isolados do Paquistão. A distância evolutiva de isolados de CMV do Paquistão foi registrada como 0,0657 entre si e 0,0574-0,2964 com outros isolados de CMV relatados em outras partes do mundo. Um fluxo gênico frequente (Fst = 0,30478 < 0,33) foi observado entre os isolados de CMV do Paquistão e relatados anteriormente. Na análise de diferenciação genética, os valores de três testes estatísticos baseados em permutação viz, Z (84,3011), Snn (0,82456) e Ks * (4,04042) não foram significativos. A análise estatística revelou os valores 2,02535, 0,01468 e 0,71862 de Tajima’s D, Fu, & Li’s F * e D * respectivamente, demonstrando que a população de CMV está sob seleção de balanceamento.

Abstract Cucumber mosaic virus (CMV) is a tremendous threat to vegetables across the globe, including in Pakistan. The present work was conducted to investigate the genetic variability of CMV isolates infecting pea and spinach vegetables in the Pothwar region of Pakistan. Serological-based surveys during 2016-2017 revealed 31.70% overall CMV disease incidence from pea and spinach crops. Triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) revealed that all the positive isolates belong to CMV subgroup II. Two selected cDNA from ELISA-positive samples representing each pea and spinach crops were PCR-amplified (ca.1100 bp) and sequenced corresponding to the CMV CP gene which shared 93.7% nucleotide identity with each other. Both the sequences of CMV pea (AAHAP) and spinach (AARS) isolates from Pakistan were submitted to GenBank as accession nos. MH119071 and MH119073, respectively. BLAST analysis revealed 93.4% sequence identity of AAHAP isolate with SpK (KC763473) from Iran while AARS isolate shared maximum identity (94.5%) with the strain 241 (AJ585519) from Australia and clustered with some reference isolates of CMV subgroup II from UK (Z12818) and USA (AF127976) in a Neighbour-joining phylogenetic reconstruction. A total of 59 polymorphic (segregating) sites (S) with nucleotide diversity (π) of 0.06218 was evident while no INDEL event was observed in Pakistani isolates. The evolutionary distance of Pakistani CMV isolates was recorded as 0.0657 with each other and 0.0574-0.2964 with other CMV isolates reported elsewhere in the world. A frequent gene flow (Fst = 0.30478 <0.33) was observed between Pakistani and earlier reported CMV isolates. In genetic differentiation analysis, the value of three permutation-based statistical tests viz; Z (84.3011), Snn (0.82456), and Ks* (4.04042) were non-significant. The statistical analysis revealed the values 2.02535, 0.01468, and 0.71862 of Tajima's D, Fu, & Li’s F* and D* respectively, demonstrating that the CMV population is under balancing selection.

ABSTRACT Brazil is a great source of arbovirus diversity, mainly in the Amazon region. However, other biomes, especially the Atlantic Forest, may also be a hotspot for emerging viruses, including Bunyaviruses (Negarnaviricota: Bunyavirales). For instance, Vale do Ribeira, located in the Southeastern region, has been widely studied for virus surveillance, where Flavivirus, Alphavirus and Bunyaviruses were isolated during the last decades, including Bruconha virus (BRCV), a member of Orthobunyavirus genus Group C, in 1976. Recently, a new isolate of BRCV named Span321532 was obtained from an adult sentinel mouse placed in Iguape city in 2011, and a full-length genome was generated with nucleotide differences ranging between 1.5%, 5.3% and 5% (L, M and S segments, respectively) from the prototype isolated 35 years earlier. In addition, each segment placed BRCV into different clusters, showing the high variety within Bunyavirales. Although no evidence for reassortants was detected, this finding reiterates the need for new surveillance and genomic studies in the area considering the high mutation rates of arbovirus, and also to identify the hosts capable of supporting the continuous circulation of Orthobunyavirus. diversity region However biomes Forest viruses Negarnaviricota (Negarnaviricota Bunyavirales . Bunyavirales) instance Ribeira Flavivirus decades BRCV, , (BRCV) C 1976 Recently Span Span32153 2011 fulllength full length 15 1 5 1.5% 53 3 5.3 L, L (L segments respectively earlier addition clusters detected (BRCV 197 Span3215 201 1.5 5. 19 Span321 20 1. Span32 2 Span3

ABSTRACT: Cats are susceptible to feline panleukopenia virus (FPV) and canine parvovirus type 2 (CPV-2). Therefore, coinfection and superinfection with multiple parvovirus strains may occur, resulting in high heterogeneity and recombination. Considering the importance of cats as a potential source of genetic diversity for parvoviruses, we investigated the frequency of parvovirus infection in cats using their blood and fecal samples and performed molecular characterization of parvovirus strains circulating in cat populations. Accordingly, the fecal and blood samples of 60 cats with gastroenteritis symptoms were collected from Turkey’s Burdur, Isparta, and Izmit provinces. Of these 15 fecal samples tested as parvovirus-positive by PCR, 14 were confirmed to have been infected with true FPV strains by sequencing analysis. Through the phylogeny analysis, those were located in the FPV cluster, closely related to CPV-2, and one was discriminated in the CPV-2b cluster. Additionally, sequence analysis of the VP2 gene of CPV and FPV revealed that the FPV strains detected in Turkey and the vaccine strains were highly related to each other, with a nucleotide identity of 97.7- 100%. Furthermore, 13 variable positions were detected in VP2 of the field and reference FPV strains. Three synonymous mutations were determined in the VP2 gene. Some amino acid mutations in the VP2 protein-affected sites were considered responsible for the virus’s biological and antigenic properties. The partial sequence analysis of the VP2 gene revealed that four FPV strains detected in Turkey have a single nucleotide change from T to G at the amino acid position 384 between the nucleotides 3939-3941, which was reported for the first time. Therefore, these four isolates formed a different branch in the phylogenetic tree. The results suggest that both FPV and CPV-2b strains are circulating in domestic cats in Turkey and cats should be considered as potential sources of new parvovirus variants for cats, dogs and other animals. ABSTRACT (FPV CPV2. CPV2 . (CPV-2) Therefore occur recombination parvoviruses populations Accordingly 6 Turkeys s Burdur Isparta provinces 1 parvoviruspositive positive PCR cluster CPV2, 2, CPV-2 CPV2b CPVb 2b b Additionally VP 97.7 977 97 7 100 100% Furthermore proteinaffected protein affected viruss properties 38 39393941, 39393941 3939 3941, 3941 3939-3941 time tree animals (CPV-2 CPV- 97. 9 10 3 3939394 393 394 3939-394 (CPV- 393939 39 3939-39 (CPV 39393 3939-3 3939-

RESUMO: Os gatos são suscetíveis ao vírus da panleucopenia felina (FPV) e ao parvovírus canino tipo 2 (CPV-2). Portanto, coinfecção e superinfecção com múltiplas cepas de parvovírus podem ocorrer, resultando em alta heterogeneidade e recombinação. Considerando a importância dos gatos como uma fonte potencial de diversidade genética para parvovírus, investigamos a frequência da infecção por parvovírus em gatos usando suas amostras de sangue e fezes e realizamos a caracterização molecular de cepas de parvovírus circulantes nas populações de gatos. Amostras fecais e de sangue de 60 gatos com sinais de gastroenterite foram coletadas nas províncias de Burdur, Isparta e Izmit, na Turquia. Destas, 15 amostras fecais testaram positivas para parvovírus por PCR e 14 foram confirmadas como infectadas com cepas verdadeiras de FPV por análise de sequenciamento. Através da análise filogenética, aqueles foram localizados no agrupamento FPV que está intimamente relacionado com o CPV-2, e um foi discriminado no agrupamento CPV-2b. Além disso, a análise da sequência do gene VP2 de CPV e FPV revelou que as cepas de FPV detectadas na Turquia e as cepas vacinais eram altamente relacionadas entre si, com uma identidade de nucleotídeos de 97,7-100%. Além disso, 13 posições variáveis foram detectadas em VP2 das cepas de campo e FPV de referência. Três mutações sinônimas foram determinadas no gene VP2. Algumas mutações de aminoácidos nos locais afetados pela proteína VP2 foram consideradas responsáveis pelas propriedades biológicas e antigênicas do vírus. A análise da sequência parcial do gene VP2 revelou que quatro cepas de FPV detectadas na Turquia têm uma única mudança de nucleotídeo de T para G na posição do aminoácido 384 entre os nucleotídeos 3939-3941, o que foi relatado pela primeira vez. Portanto, esses quatro isolados formaram um ramo diferente na árvore filogenética. Os resultados sugerem que ambas as cepas FPV e CPV-2b estão circulando em gatos domésticos na Turquia e os gatos devem ser considerados como fontes potenciais de novas variantes de parvovírus para gatos, cães e outros animais. RESUMO (FPV CPV2. CPV2 . (CPV-2) Portanto ocorrer recombinação 6 Burdur Izmit Destas 1 sequenciamento filogenética CPV2, 2, CPV-2 CPV2b. CPV2b CPVb 2b. 2b b disso VP si 97,7100%. 977100 97,7 100%. 97 7 100 97,7-100% referência 38 39393941, 39393941 3939 3941, 3941 3939-3941 vez animais (CPV-2 CPV- 7100 97,7100% 97710 977 97, 100% 9 10 97,7-100 3 3939394 393 394 3939-394 (CPV- 710 97,7100 9771 97,7-10 393939 39 3939-39 (CPV 71 97,710 97,7-1 39393 3939-3 97,71 97,7- 3939-