Abstract Introduction: A recent revision of the generic classification of the Trochilidae based on DNA sequences revealed many inconsistencies with the current generic classification, largely based on plumage characters subject to homoplasy, especially in the Trochilini, the largest tribe. A thorough generic reorganization brought the classification into accord with the phylogeny, but due to lack of genetic data, two species remained unclassified. One of these was the Mangrove Hummingbird, “Amazilia” boucardi, endemic to Costa Rica and included in the IUCN red list of threatened species. Objective: To obtain molecular evidence to clarify the generic relationships of “A.” boucardi. Methods: We isolated DNA from tissues of this species and amplified 4 nuclear and 4 mitochondrial fragments and compared these with homologous fragments from 56 species in the Trochilini, constructing phylogenetic trees with maximum likelihood and Bayesian methods. Results: Our phylogenetic analyses confirmed the placement of boucardi in the Trochilini and definitely excluded it from Amazilia but placed it with high confidence in the genus Chrysuronia Bonaparte, 1850, within which its closest relative is C. coeruleogularis, which also inhabits mangroves. Conclusions: Our genetic data based on nuclear and mitochondrial regions clearly indicate the relationship of A. boucardi and L. coeruleogularis. Moreover, it is also supported by their habitat distribution in the mangroves of the Pacific coast of Costa Rica and Western Panama. Therefore, we suggested to exclude A. boucardi as “incertae sedis”.

Resumen Introducción: Una revisión reciente de la clasificación de la familia Trochilidae con base en secuencias de ADN demostró muchas incongruencias con la clasificación genérica previa, que había sido hecho con base en caracteres del plumaje muy sujetos a homoplasia, especialmente en la tribu más grande, Trochillini. Una reorganización de los géneros logró llevar su clasificación genérica a la concordancia con la filogenia, pero debido a la ausencia de datos genéticos, dos especies permanecieron sin clasificar. Una de estas fue el colibrí de manglar Amazilia boucardi, una especie endémica de Costa Rica, considerada como amenazada en la lista roja de la UICN. Objetivo: Obtener evidencia molecular para esclarecer las relaciones genéricas de A. boucardi. Métodos: Se aisló ADN de tejidos de esta especie y se amplificaron 4 fragmentos de ADN del núcleo y 5 de la mitocondria, y se compararon con fragmentos homólogos de 56 especies en la tribu Trochillini, generando árboles filogenéticos con métodos de máxima verosimilitud y bayesiano. Resultados: Los análisis filogénticos obtenidos confirmaron la ubicación de boucardi en Trochilini y definitivamente la excluyó del género Amazilia, pero la ubicó con un alto grado de confianza en el género Chrysuronia Bonaparte, 1850, dentro los cuales su pariente más cercano es C. coeruleogularis, que también habita manglares. Conclusiones: Nuestros datos genéticos basados en regiones nucleares y mitocondriales indican claramente la relación entre A. boucardi and L. coeruleogularis. Es más, lo anterior se sustenta por su distribución en los manglares de la costa Pacífica de Costa Rica y oeste de Panamá. Por lo tanto, sugerimos excluir a A. boucardi como “incertae sedis”.

Abstract Introduction: Chacón-Monge et al. (2024) sought to test the accuracy of DNA barcoding for species identification in Pacific Central American shallow water echinoderms. They used cytochrome c oxidase I (COI) sequences derived from new material collected as part of the BioMar-ACG project in Costa Rica. Using their set of 348 echinoderm sequences, they compared species identification results from two online platforms: the National Center for Biotechnology Information (NCBI) GenBank using the nucleotide Basic Local Alignment Search Tool (BLASTn), and the Barcode of Life Data Systems (BOLD) Identification Engine. Objective: The present article is a response to their results and conclusions. Methods: We reinterpreted the results from the authors’ Appendix 2 to enable an objective comparison between the BOLD Identification Engine and BLASTn in GenBank. Results: While the authors found that both platforms were limited by the number of reference sequences available in their respective databases, they concluded that GenBank outperformed BOLD for identification; however, we identify several methodological flaws in their analysis. These include pseudoreplication amongst query sequences, contaminated sequences stemming from sampling errors, and a lack of standardization when interpreting results from the two platforms. Their assessment of the BOLD Identification Engine was also limited by improper selection of a reference database. Conclusion: Addressing these errors, we reinterpret their results and demonstrate that there is no difference in performance between the two platforms.

Resumen Introducción: Chacón-Monge et al. (2024) intentaron probar la precisión de los códigos de barras de ADN para identificar especies de equinodermos de aguas poco profundas del Pacífico Centroamericano. Para ello, utilizaron secuencias de citocromo c oxidasa I (COI) provenientes de material recolectado recientemente como parte del proyecto BioMar-ACG en Costa Rica. Utilizando 348 secuencias de equinodermos, compararon los resultados de identificación de especies de dos plataformas en línea: GenBank del Centro Nacional de Información Biotecnológica (NCBI) empleando la herramienta de búsqueda de alineación local básica de nucleótidos (BLASTn) y la herramienta de identificación del Sistema de Datos del Código de Barras de la Vida (BOLD). Objetivo: El presente artículo es una respuesta a sus resultados y conclusiones. Métodos: Reinterpretamos los resultados presentados por los autores en Apéndice 2 para comparar objetivamente el sistema de identificación de BOLD y el de BLASTn en GenBank. Resultados: Si bien los autores encontraron que ambas plataformas estaban limitadas por la cantidad de secuencias de referencia disponibles en sus bases de datos, concluyeron que GenBank superó a BOLD en la identificación de especies; sin embargo, notamos varias fallas metodológicas en su análisis. Estas incluyeron la pseudorreplicación entre las secuencias consultadas, el uso de secuencias contaminadas derivadas de errores de muestreo y falta de estandarización al interpretar los resultados de las dos plataformas. Su evaluación del sistema de identificación de BOLD se vio limitada por la selección inadecuada de una base de datos de referencia. Conclusión: Teniendo en cuenta estos errores, reinterpretamos sus resultados y demostramos que no existe una diferencia significativa en el rendimiento de ambas plataformas.

SUMMARY: Formaldehyde induces oxidative damage in hippocampal tissue and blood serum by suppressing antioxidant defenses and increasing lipid peroxidation. This results in damage to DNA, proteins, and lipids within cells, disrupting neuronal functions, and may even lead to cell death (apoptosis). Apoptosis occurs as a cellular response triggered by formaldehyde through various mechanisms, including mitochondrial dysfunction, oxidative stress, and DNA damage. Arbutus unedo L. (AUL), which is rich in antioxidants, represents a potential countermeasure. The aim of our study is to investigate the immunohistochemical and biochemical effects of AUL fruit extract (AUE) on apoptosis and oxidative stress induced by FA exposure in the rat hippocampus. The rats were divided into four groups: the experimental group (EG) received 20 mg/kg AUE by oral gavage and 10 ppm FA inhalation; the formaldehyde group (FG) received 10 ppm FA inhalation only; the sham group (SG) received 10 mg/kg AUE by oral gavage; and the control group (CG) underwent routine observation. Hippocampal tissue was isolated after blood sampling. A number of physical changes, such as yellowing of feathers and tail spots, were observed in FA-exposed groups. The biochemical analysis showed significant differences in brain-derived neurotrophic factor (BDNF), malondialdehyde (MDA), GSH (Glutathione) and nitric oxide (NO) levels between the groups. The AUE-treated groups had reduced MDA levels, suggesting a potential reduction in oxidative stress, along with lower apoptotic cell rates in caspase-3 assessments. The FG rats had lower BDNF levels than CG. The SG had the fewest apoptotic cells. All these findings indicate AUE's potential to mitigate neuron damage and reduce oxidative stress.

RESUMEN: El formaldehído induce daño oxidativo en el tejido del hipocampo y del plasma sanguíneo al suprimir las defensas antioxidantes y aumentar la peroxidación lipídica. Esto provoca daños en el ADN, las proteínas y los lípidos dentro de las células, alterando las funciones neuronales e incluso puede provocar la muerte celular (apoptosis). La apoptosis se produce como una respuesta celular desencadenada por el formaldehído a través de diversos mecanismos, incluida la disfunción mitocondrial, el estrés oxidativo y el daño del ADN. Arbutus unedo L. (AUL), rico en antioxidantes, representa una posible contramedida. El objetivo de nuestro estudio fue investigar los efectos inmunohistoquímicos y bioquímicos del extracto de fruta AUL (AUE) sobre la apoptosis y el estrés oxidativo inducido por la exposición a FA en el hipocampo de rata. Las ratas se dividieron en cuatro grupos: el grupo experimental (GE) recibió 20 mg/kg de AUE por sonda oral y 10 ppm de FA por inhalación; el grupo de formaldehído (GF) recibió sólo una inhalación de 10 ppm de FA; el grupo simulado (GS) recibió 10 mg/kg de AUE mediante sonda oral; y el grupo control (GC) se sometió a observación de rutina. Se aisló tejido del hipocampo después de una muestra de sangre. En los grupos expuestos a FA se observaron una serie de cambios físicos, como coloración amarillenta del pelaje y manchas en la cola. El análisis bioquímico mostró diferencias significativas en los niveles de factor neurotrófico derivado del cerebro (BDNF), malondialdehído (MDA), GSH (glutatión) y óxido nítrico (NO) entre los grupos. Los grupos tratados con AUE tenían niveles reducidos de MDA, lo que sugiere una reducción potencial del estrés oxidativo, junto con tasas de células apoptóticas más bajas en las evaluaciones de caspasa-3. Las ratas GF tenían niveles de BDNF más bajos que GC. El GS tenía la menor cantidad de células apoptóticas. Todos estos hallazgos indican el potencial del AUE para mitigar el daño neuronal y reducir el estrés oxidativo.

ABSTRACT. Oreochromis niloticus is the most important aquacultural species worldwide. Several countries are interested in repopulating natural or artificial reservoirs with the fry of tilapia (Oreochromis sp.) to develop new fisheries or to enhance the existing ones. However, as tilapia is considered an invasive species, it is essential to check the existence of the species in the place before releasing any fry. Characterization of tilapia species with meristic is unreliable because of existing morphological similarities among species. In this work, the composition of the tilapia species of Laguna El Mastranzo (LEM), Nayarit, Mexico, was explored for the first time through a molecular method using the mitochondrial DNA control region. Three tilapia species (Oreochromis niloticus, O. aureus, and O. urolepis) were found in LEM, and it was confirmed that the two commercial strains (Aquamol and Spring) intended for repopulation were O. niloticus. Seven haplotypes of mitochondrial DNA control region sequences were obtained: three in LEM, three in Aquamol, and one in Spring strains. Before repopulating any reservoir, a molecular verification strategy is recommended to avoid spreading the species. The results of this work represent a glimpse into the genetic material of LEM, Nayarit, Mexico.

ABSTRACT Purpose Varicocele is a condition known to cause damage to seminal parameters and sperm function. Furthermore, it has been hypothesized that the varicocele effect on fertility is time-dependent; however, little is known about the consequences of its establishment time on reproductive organs and/or sperm function. This study aimed to evaluate the effect of the duration of experimental varicocele on reproductive organs, sperm parameters, and sperm function. Materials and Methods Varicocele induction surgeries were performed in Wistar rats aged 40 or 100 days old. At 160-day-old, analyses were performed, including biometry of reproductive organs (prostate, seminal vesicles, epididymis, and testis), sperm parameters (vitality, morphology, and motility), and sperm function tests (nuclear DNA integrity, acrosome integrity, and mitochondrial activity). Results The analysis of the biometry of reproductive organs showed no differences between distinct ages in which varicocele was induced. The total abnormal sperm morphology was bigger in animals with varicocele induced to 100 days old than in animals with varicocele induced to 40 days old. Regarding nuclear DNA integrity, animals of varicocele induced to 100 days old showed worse results compared to animals of varicocele induced to 40 days old. Other parameters analyzed showed no differences between varicocele groups. Conclusion In this study conducted on rats, we conclude that varicocele adversely affects sperm, particularly its function. However, we did not observe a negative progressive effect on sperm. Furthermore timedependent dependent time-dependent however andor 4 10 160dayold, 160dayold dayold 160 day old, 160-day-old prostate, prostate (prostate vesicles epididymis testis, testis , testis) vitality, vitality (vitality motility, motility motility) integrity activity. activity . activity) groups However 1 16

ABSTRACT: Members of the genus Lanius, known as shrikes, are economically important song birds distributed widely in several Asian countries. DNA sequencing, based on a partial segment of the cytochrome oxidase b (Cyt b) gene, was used to determine genetic variations and population genetic structure in four populations of shrike samples from north, east, and west Pakistan. We observed nucleotide diversities in L. isabellinus(= 0.02), L. schach(= 0.005), L. vittatus(= 0.004) and L. lahtora(= 0.008) . FST values were significant (P < 0.05) in all species populations apart from L. isabellinus, which were non-significant. The negative values of Fu’s Fs and Tajima’s D showed significant population expansion in three species, L. schach, L. vittatusand L. Lahtora, whereas they were insignificant in populations of L. isabellinus. Fu’s Fs and Tajima’s D values explain that a strong genetic structure is present among members of L. isabellinus. On this basis, it is inferred that strong genetic structuring in L. isabellinuspopulations within this region was largely shaped by a common origin, with secondary influences from geographical factors and isolation. ABSTRACT Lanius shrikes countries sequencing Cyt gene north east Pakistan L isabellinus= isabellinus = isabellinus( 0.02, 002 0.02 , 0 02 0.02) schach= schach schach( 0.005, 0005 0.005 005 0.005) vittatus= vittatus vittatus( 0.004 0004 004 lahtora= lahtora lahtora( 0.008 0008 008 P 0.05 05 nonsignificant. nonsignificant non significant. non-significant Fus Fu s Tajimas Tajima Lahtora basis origin isolation 00 0.0 000 0.00 0.

RESUMO: Membros do gênero Lanius, conhecidos como picanços, são pássaros canoros economicamente importantes, amplamente distribuídos em vários países asiáticos. O sequenciamento de DNA, baseado em um segmento parcial do gene citocromo oxidase b (Cyt b), foi usado para determinar as variações genéticas e a estrutura genética da população em quatro populações de amostras de picanço do norte, leste e oeste do Paquistão. As diversidades de nucleotídeos em L. isabellinus (= 0,02), L. schach (= 0,005), L. vittatus (= 0,004) e L. lahtora (= 0,008) foram observadas. Os valores de FST foram significativos (P < 0,05) em todas as populações de espécies, exceto L. isabellinus, que não foram significativos. Os valores negativos de Fs de Fu e D de Tajima mostraram expansão populacional significativa em três espécies, L. schach, L. vittatus e L. Lahtora, enquanto foram insignificantes em populações de L. isabellinus. Os valores Fs de Fu e D de Tajima explicam que uma forte estrutura genética está presente entre os membros de L. isabellinus. Com base nisso, infere-se que a forte estruturação genética nas populações de L. isabellinus nessa região foi amplamente moldada por uma origem comum, com influências secundárias de fatores geográficos e isolamento. RESUMO Lanius picanços importantes asiáticos DNA Cyt b, , b) norte Paquistão L = ( 0,02, 002 0,02 0 02 0,02) 0,005, 0005 0,005 005 0,005) 0,004 0004 004 0,008 0008 008 observadas P 0,05 05 espécies Lahtora nisso inferese infere se comum isolamento 00 0,0 000 0,00 0,

Abstract This paper presents the first results on the maternal continental origin of the main localities in the province of Tierra del Fuego (TDF): Río Grande (RG) and Ushuaia (USH), by typing of mitochondrial haplogroups (Hg) in 333 participants. The estimation of Hg was carried out using PCR-APLP and sequencing of the HV1 region, evidencing a significant frequency of maternal Hg of American origin at the provincial level (64.9%). At the local level, a higher proportion of autochthonous lineages was observed in RG (75.1%) compared to USH (57.5%). From the genealogical information of the participants, it was verified that the most frequent geographical origin of both participants and ancestors is the Central region of Argentina. The differences observed between the two localities, which are only 200 km away, in a province with low demographic density, once again highlight the importance of knowing the genealogical information of the participants, as well as the founding history and economic activities of each locality that have motivated the arrival of migrants, to achieve a better contextualization and understanding of the current genetic composition of the province of TDF. Rev Arg Antrop Biol 26(1), 071, 2024. https://doi.org/10.24215/18536387e071

Resumen En este trabajo se presentan los primeros resultados sobre el origen continental materno de las principales localidades de la provincia de Tierra del Fuego (TDF): Río Grande (RG) y Ushuaia (USH), mediante la tipificación de haplogrupos mitocondriales (Hg) de 333 participantes. La estimación de los Hg se realizó mediante PCR-APLP y secuenciación de la región HV1, evidenciando una significativa frecuencia de Hg maternos de origen americano a nivel provincial (64,9%). A nivel local, se observó una mayor proporción de linajes autóctonos en RG (75,1%) respecto de USH (57,5%). A partir de la información genealógica de los participantes, se evidenció que el origen geográfico más frecuente tanto de los participantes como de los ancestros, es la región Centro de Argentina. Las diferencias observadas entre dos localidades que distan a sólo 200 km, en una provincia de baja densidad demográfica, ponen en evidencia una vez más la importancia de conocer la información genealógica de los participantes, así como la historia fundacional y las actividades económicas de cada localidad que han motivado la llegada de migrantes, para una adecuada contextualización y comprensión de la actual composición genética de la provincia de TDF. Rev Arg Antrop Biol 26(1), 071, 2024. https://doi.org/10.24215/18536387e071

Abstract Introduction: Molecular divergence thresholds have been proposed to distinguish recently separated evolutive units, often displaying more accurate putative species assignments in taxonomic research compared to traditional morphological approaches. This makes DNA barcoding an attractive identification tool for a variety of marine invertebrates, especially for cryptic species complexes. Although GenBank and the Barcode of Life Data System (BOLD) are the major sequence repositories worldwide, very few have tested their performance in the identification of echinoderm sequences. Objective: We use COI echinoderm sequences from local samples and the molecular identification platforms from GenBank and BOLD, in order to test their accuracy and reliability in the DNA barcoding identification for Central American shallow water echinoderms, at genus and species level. Methods: We conducted sampling, tissue extraction, COI amplification, sequencing, and taxonomic identification for 475 specimens. The 348 obtained sequences were individually enquired with BLAST in GenBank as well as using the Identification System (IDS) in BOLD. Query sequences were classified depending on the best match result. McNemar’s chi-squared, Kruskal-Wallis’s and Mann-Whitney’s U tests were performed to prove differences between the results from both databases. Additionally, we recorded an updated list of species reported for the shallow waters of the Central American Pacific. Results: We found 324 echinoderm species reported for Central American Pacific shallow waters. Only 118 and 110 were present in GenBank and BOLD databases respectively. We proposed 325 solved morphology-based identities and 21 provisional identifications in 50 putative taxa. GenBank retrieved 348 molecular-based identifications in 58 species, including twelve provisional identifications in tree taxa. BOLD recovered 170 COI identifications in 23 species with one provisional identification. Nevertheless, 178 sequences retrieved unmatched terms (in 34 morphology-based taxa). Only 86 sequences (25 %) were retrieved as correct identifications and 128 (37 %) as identification errors in both platforms. We include 84 sequences for eleven species not represented in GenBank and 65 sequences for ten species in BOLD Echinoderm COI databases. The identification accuracy using BLAST (175 correct and 152 incorrect identifications) was greater than with IDS engine (110 correct and 218 identification errors), therefore GenBank outperforms BOLD (Kruskal-Wallis = 41.625, df = 1, p < 0.001). Conclusions: Additional echinoderm sample references are needed to improve the utility of the evaluated DNA barcoding identification tools. Identification discordances in both databases may obey specific parameters used in each search algorithm engine and the available sequences. We recommend the use of barcoding as a complementary identification source for Central American Pacific shallow water echinoderm species.

Resumen Introducción: Se han propuesto los umbrales de divergencia molecular para distinguir unidades evolutivas recientemente separadas, que a menudo muestran asignaciones de especies putativas más precisas en la investigación taxonómica en comparación con los enfoques morfológicos tradicionales. Esto hace que los Códigos de Barras de ADN sean una herramienta de identificación atractiva para una variedad de invertebrados marinos, especialmente para complejos de especies crípticas. Aunque GenBank y Barcode of Life Data System (BOLD) son los principales repositorios de secuencias en todo el mundo, muy pocos han probado su desempeño en la identificación de secuencias de equinodermos. Objetivo: Utilizamos secuencias de equinodermos COI de muestras locales y las plataformas de identificación molecular de GenBank y BOLD, para probar su precisión y confiabilidad en la implementación de códigos de barras de ADN para equinodermos de aguas someras de Centroamérica, a nivel de género y especie. Métodos: Realizamos muestreo, extracción de tejido, amplificación de COI, secuenciación e identificación taxonómica de 475 especímenes. Las 348 secuencias obtenidas fueron consultadas individualmente con BLAST en GenBank así como utilizando el Sistema de Identificación (IDS) en BOLD. Las secuencias consultadas se clasificaron según el mejor resultado de coincidencia. Se realizaron las pruebas chi-cuadrado de McNemar, Kruskal-Wallis y U de Mann-Whitney para comprobar diferencias entre los resultados de ambas bases de datos. Además, registramos una lista actualizada de especies reportadas para las aguas someras del Pacífico Centroamericano. Resultados: Encontramos 324 especies de equinodermos reportadas para aguas someras (< 200 m) del Pacífico centroamericano. Sólo 118 y 110 estaban presentes en las bases de datos GenBank y BOLD respectivamente. Propusimos 325 identidades resueltas basadas en morfología y 21 identificaciones provisionales en 50 taxones putativos. GenBank recuperó 348 identificaciones de base molecular en 58 especies, incluidas doce identificaciones provisionales en tres taxones. BOLD recuperó 170 identificaciones de COI en 23 especies con una identificación provisional. Sin embargo, 178 secuencias recuperaron términos no coincidentes (en 34 taxones basados en morfología). Sólo 86 secuencias (25 %) se recuperaron como identificaciones correctas y 128 (37 %) como errores de identificación en ambas plataformas. Incluimos 84 secuencias para once especies no representadas en GenBank y 65 secuencias para diez especies ausentes en las bases de datos BOLD Echinoderm COI. La precisión de la identificación usando BLAST (175 identificaciones correctas y 152 incorrectas) fue mayor que con el motor IDS (110 correctas y 218 errores de identificación), por lo tanto, GenBank supera a BOLD (Kruskal-Wallis = 41.625, df = 1, p < 0.001). Conclusiones: Se necesitan muestras adicionales de equinodermos de referencia para mejorar la utilidad de las herramientas de identificación de códigos de barras de ADN evaluadas. Las discordancias de identificación en ambas bases de datos pueden obedecer a parámetros específicos utilizados en cada algoritmo de búsqueda y a las secuencias disponibles. Recomendamos el uso de códigos de barras como fuente de identificación complementaria para las especies de equinodermos de aguas someras del Pacífico centroamericano.

Abstract Introduction: Echinoderms, an integral component of marine ecosystems worldwide, have captivated scientific interest for centuries. Despite this longstanding attention, comprehending key facets such as trophic relationships, diet composition, and host-microbiota relationships still represents a challenge using traditional techniques. Recent years, however, have witnessed a transformative shift, thanks to the emergence of advanced molecular techniques, offering new approaches to strengthen ecological studies in echinoderms. Objective: Explore how recent advancements in molecular tools have impacted ecological research on echinoderms. Specifically, we aim to investigate the potential of these tools to shed light on trophic interactions, diet composition, and the characterization of gut microbial communities in these organisms. Methods: Available literature was used to clarify how novel molecular techniques can improve ecological studies. The focus is diet, trophic relationships, and gut microbiota. Results: Traditionally, studies of stomach contents using compound microscopy have provided an idea of ingested material; nevertheless, sometimes a simple magnified visualization of dietary content does not allow exhaustive identification of the entire food spectrum, as it is limited due to the rapid digestion and maceration of food items within the echinoderm’s digestive tract. The use of DNA-metabarcoding, targeting specific DNA regions, such as the mitochondrial COI gene, has allowed us to enhance the accuracy and precision of diet characterization by enabling the identification of prey items down to the species or even genetic variant level, providing valuable insights into specific dietary preferences. Another approach is the use of stable isotopes, particularly carbon and nitrogen, which provide a powerful tool to trace the origin and flow of nutrients through food webs. By analyzing the isotopic signatures in muscular tissues and food items, we can discern the sources of their primary food items and gain insights into their trophic position within the ecosystem. Lastly, a third new technique used to elucidate the characterization of the prokaryotic community is 16S rRNA sequencing. This method allows us to explore the composition and dynamics of the digestive tract microbial communities. Conclusions: This is a promising era for ecological research on echinoderms, where advances of molecular tools have enabled an unprecedented level of detail, resolving longstanding challenges in comprehending their trophic interactions, diet composition, and host-microbiota relationships, and opening new avenues of investigation in ecological studies.

Resumen Introducción: Los equinodermos, un componente integral de los ecosistemas marinos en todo el mundo, han captado el interés científico durante siglos. A pesar de esta prolongada atención, el comprender facetas clave como las relaciones tróficas, la composición de la dieta y las relaciones huésped-microbiota todavía representa un desafío utilizando técnicas tradicionales. Sin embargo, los últimos años han sido testigos de un cambio transformador, gracias a la aparición de técnicas moleculares avanzadas, que ofrecen nuevos enfoques para fortalecer los estudios ecológicos en equinodermos. Objetivo: Explorar cómo los avances recientes en herramientas moleculares han impactado la investigación ecológica sobre equinodermos. Específicamente, nuestro objetivo es investigar el potencial de estas herramientas para arrojar luz sobre las interacciones tróficas, la composición de la dieta y la caracterización de las comunidades microbianas intestinales en estos organismos. Métodos: Se utilizó la literatura disponible para aclarar cómo las nuevas técnicas moleculares pueden mejorar los estudios ecológicos. La atención se centra en la dieta, las relaciones tróficas y la microbiota intestinal. Resultados: Tradicionalmente, los estudios del contenido estomacal mediante microscopía compuesta han proporcionado una idea del material ingerido; Sin embargo, a veces una simple visualización ampliada del contenido dietético no permite una identificación exhaustiva de todo el espectro alimentario, ya que está limitado debido a la rápida digestión y maceración de los alimentos dentro del tracto digestivo del equinodermo. El uso de metabarcoding de ADN, dirigidos a regiones específicas del ADN, como el gen COI mitocondrial, nos ha permitido mejorar la exactitud y precisión de la caracterización de la dieta al permitir la identificación de presas hasta el nivel de especie o incluso de variante genética, lo que proporciona valiosos resultados sobre preferencias dietéticas específicas. Otro enfoque es el uso de isótopos estables, en particular carbono y nitrógeno, que proporcionan una poderosa herramienta para rastrear el origen y el flujo de nutrientes a través de las redes alimentarias. Al analizar las firmas isotópicas en los tejidos musculares y los alimentos, podemos discernir las fuentes de sus alimentos primarios y obtener información sobre su posición trófica dentro del ecosistema. Por último, una tercera técnica nueva utilizada para dilucidar la caracterización de la comunidad procariótica es la secuenciación del ARNr 16S. Este método nos permite explorar la composición y dinámica de las comunidades microbianas del tracto digestivo. Conclusiones: Esta es una era prometedora para la investigación ecológica sobre equinodermos, donde los avances de las herramientas moleculares han permitido un nivel de detalle sin precedentes, resolviendo desafíos de larga data en la comprensión de sus interacciones tróficas, composición de la dieta y relaciones huésped-microbiota, y abriendo nuevas vías de investigación. en estudios ecológicos.

Abstract Mackerel fish (Scomberomorus spp.) represents a significant marine fisheries commodity in Indonesia, characterized by its high commercial value and nutritional content. To understand the intraspecific interactions and genetic variability of Scomberomorus spp., a more extensive research of Scomberomorus spp. populations, including both cultivated and wild specimens, is required. This study aimed to explore the genetic diversity of mackerel fish in Indonesian waters, focusing on the mitochondrial DNA (mtDNA) cytochrome oxidase subunit II (COII) gene, which encodes the second subunit of cytochrome c oxidase (complex IV), is essential for aerobic respiration and energy transformation. Muscle tissue samples from 18 individual mackerel fish collected from various regions in Indonesia, including Palembang, Cilacap, Rembang, Banjarmasin, Ambon, and Fak-Fak Regencies, were utilized. The genomic DNA was isolated and amplified using specific primers: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') and CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Subsequently, the obtained amplicons were subjected to sequencing. The sequence data were then analyzed using the MEGA11 and DnaSP 6 software. Our findings revealed 120 variable sites within the 691 base pairs of mtDNA COII sequences, resulting in a nucleotide diversity (Pi) of 0.07169. Furthermore, we identified eight haplotypes, demonstrating a haplotype diversity (Hd) of 0.8889. Remarkably, all mackerel samples from Palembang and Cilacap clustered into discrete haplotypes, specifically haplotype 1 and haplotype 2, respectively. Our phylogenetic analysis delineated three distinct clades. Clade I, closely related to Scomberomorus cavalla, encompassed all individuals from Ambon, Palembang, Rembang, and one from Banjarmasin. Clade II, associated with Scomberomorus niphonius, included individuals from Cilacap and two from Banjarmasin. Clade III, linked to Scomberomorus semifasciatus, exclusively consisted of individuals from Fak-Fak (Papua). In conclusion, Indonesian waters harbor diverse genetic variations within Scomberomorus spp., and population relationships based on the mtDNA COII gene exhibit notable complexities. Future research endeavors should focus on further elucidating the diversity and relationships among Scomberomorus spp. in diverse Indonesian populations. spp Indonesia content populations specimens required (mtDNA (COII complex IV, IV , IV) transformation Rembang Banjarmasin Ambon FakFak Fak Regencies utilized primers COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Subsequently sequencing MEGA MEGA1 software 12 69 sequences Pi (Pi 007169 0 07169 0.07169 Furthermore haplotypes Hd (Hd 08889 8889 0.8889 Remarkably 2 respectively clades I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusion complexities 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0.0716 0888 888 0.888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0.071 088 88 0.88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0.07 08 8 0.8 (5'-ATGTCACTAAGGGTGGTTGG 00 0.0 0.

Resumo O peixe cavala (Scomberomorus spp.) representa uma importante commodity da pesca marinha na Indonésia, caracterizada pelo seu alto valor comercial e conteúdo nutricional. Para entender as interações intraespecíficas e a variabilidade genética do Scomberomorus spp., é necessária uma pesquisa mais ampla das populações de Scomberomorus spp. Este estudo teve como objetivo explorar a diversidade genética do peixe cavala nas águas da Indonésia, com foco no gene mitocondrial do DNA (mtDNA) da subunidade II da citocromo oxidase (COII) que codifica a segunda subunidade da citocromo c oxidase (complexo IV), essencial para a respiração aeróbica e a transformação de energia. Foram utilizadas amostras de tecido muscular de 18 peixes cavala individuais, coletados de diversas regiões da Indonésia, incluindo Palembang, Cilacap, Rembang, Banjarmasin, Ambon e Regiões de Fak-Fak. O DNA genômico foi isolado e amplificado utilizando iniciadores específicos: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') e CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Posteriormente, os amplicons obtidos foram submetidos a sequenciamento. Os dados de sequência foram então analisados usando o software MEGA 11 e DnaSP 6. Nossos resultados revelaram um total de 120 sítios variáveis dentro dos 691 pares de bases das sequências de mtDNA COII, resultando em uma diversidade de nucleotídeos (Pi) de 0,07169. Além disso, identificamos oito haplótipos distintos, demonstrando uma diversidade haplotípica (Hd) de 0,8889. Notavelmente, todas as amostras de peixe cavala de Palembang e Cilacap se agruparam em haplótipos distintos, especificamente haplótipo 1 e haplótipo 2, respectivamente. Nossa análise filogenética delineou três clados distintos. O Clado I, intimamente relacionado ao Scomberomorus cavalla, englobou todos os indivíduos de Ambon, Palembang, Rembang e um de Banjarmasin. O Clado II, associado ao Scomberomorus niphonius, incluiu indivíduos de Cilacap e dois de Banjarmasin. O Clado III, ligado ao Scomberomorus semifasciatus, consistiu exclusivamente de indivíduos de Fak-Fak (Papua). Em conclusão, as águas indonésias abrigam diversas variações genéticas dentro de Scomberomorus spp., e as relações populacionais com base no gene mtDNA COII apresentam complexidades notáveis. Futuros empreendimentos de pesquisa devem se concentrar em elucidar ainda mais a diversidade e as relações entre as populações de Scomberomorus spp. em diversas regiões da Indonésia. spp Indonésia nutricional (mtDNA (COII complexo IV, IV , IV) energia individuais Banjarmasin FakFak. FakFak Fak Fak. específicos COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Posteriormente sequenciamento 6 12 69 Pi (Pi 007169 0 07169 0,07169 disso distintos Hd (Hd 08889 8889 0,8889 Notavelmente 2 respectivamente I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusão notáveis 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0,0716 0888 888 0,888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0,071 088 88 0,88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0,07 08 8 0,8 (5'-ATGTCACTAAGGGTGGTTGG 00 0,0 0,

Resumo O burro doméstico possui um papel fundamental como animal de tração na economia rural do Paquistão, onde a população desse animal está aumentando a cada ano. A região de controle de mtDNA completa de 40 burros amostrados aleatoriamente foi ampliada por PCR e sequenciada bidirecionalmente por intermédio de primers específicos. Haplótipos distintos de mtDNA obtidos no estudo atual (KY446001 − KY446011) foram submetidos a medidas de haplótipo (h) e diversidade de nucleotídeos (π) por meio de DnaS, bem como análises filogenéticas, de rede e AMOVA. Havia um total de 27 sítios polimórficos presentes em 11 haplótipos de mtDNA exclusivos dos 40 animais estudados de diferentes regiões. A rede de união de vizinhos e a rede de união mediana ilustram a divisão de todos esses haplótipos em duas linhagens núbias e somalis bem definidas, confirmando a origem materna africana do burro doméstico do Paquistão. Os parâmetros de diversidade h (0,967 ± 0,037) e π (0,02917 ± 0,00307) revelaram altos níveis de diversidade genética em burros paquistaneses. AMOVA demonstrou apenas 1% de diferenças genéticas entre as duas linhagens maternas de mtDNA, apontando a falta de subestrutura populacional em burros paquistaneses, como é o caso da população mundial de burros domésticos. Os burros paquistaneses têm origem materna africana e altos níveis de diversidade de mtDNA. A alta diversidade genética pode ser por causa da reprodução não seletiva e de heteroplasmia. Aqui, fornecemos o primeiro relatório sobre a diversidade do mtDNA da região de controle em burros domésticos do Paquistão.

Abstract Domestic donkey plays a key role as a draft animal in rural economy of Pakistan where its population is increasing every year. The complete mtDNA control region of forty randomly sampled donkeys was PCR- amplified and sequenced bi-directionally using specific primers. Distinct mtDNA haplotypes obtained in the current study (KY446001−KY446011) were subjected to haplotype (h) and nucleotide diversity (π) measures using DnaS as well as to phylogenetic, Network, and AMOVA analyses. There were a total 27 polymorphic sites present within 11 unique mtDNA haplotypes from the studied 40 animals from different regions. Neighbor-joining network and median-joining network both illustrated the splitting of all these haplotypes into two well-defined Nubian and Somali lineages, confirming African maternal origin of Pakistani domestic donkey. Diversity parameters h (0.967± 0.037) and π (0.02917± 0.00307) were found to reveal high levels of genetic diversity in Pakistani donkeys. AMOVA demonstrated only 1% of genetic differences between two mtDNA maternal lineages, pointing to lack of population substructure in Pakistani donkeys as is the case with worldwide domestic donkey population. Pakistani donkeys have African maternal origin and high levels of mtDNA diversity. High genetic diversity may be due to non-selective breeding and heteroplasmy. We herein provide the first report on mtDNA diversity of control region in Pakistani domestic donkey.

Resumo Bemisia tabaci é um complexo de espécies que causa danos a uma ampla gama de hospedeiros vegetais por meio de alimentação séria. Ele transmite vírus de plantas de diferentes grupos para importantes safras agrícolas. Algumas safras comerciais importantes do Paquistão são cana-de-açúcar, arroz, tabaco e óleo de semente. Apresenta alta variabilidade genética e é diferenciado em raças ou biótipos. Os biótipos são: biótipo Q, biótipo B, biótipo B2, biótipo M, biótipo L, biótipo A, biótipo H, biótipo C, biótipo K, biótipo N, biótipo R, biótipo E, biótipo P, biótipo J, biótipo S, biótipo AN . Embora o relatório atual baseado no estudo bayesiano das sequências de DNA do gene 1 da oxidase do citocromo mitocondrial (CO1) tenha classificado as diferentes populações de moscas-brancas em doze grupos genéticos, que são Mediterrâneo, África Subsaariana com folha de prata, Oceano Índico, Ásia II, Ásia I, Austrália, Novo Mundo, Itália, China, África Subsaariana sem folha prateada, Batata-doce Mediterrâneo / Ásia Menor / África e Uganda. Os begomovírus são o maior grupo de vírus transmitidos por B. tabaci e causam as principais doenças de culturas, como a doença do cacho do tomate e da pimenta-malagueta, doença do mosaico da mandioca, doença do mosaico amarelo de leguminosas e doença do enrolamento da folha do algodão. O principal objetivo do presente estudo é inculpar conhecimento sobre a diversidade genética da mosca-branca em campos de algodão em todo o Paquistão por meio da análise da sequência parcial de DNA do gene mitocondrial Citocromo Oxidase I (mtCO1).

Abstract Bemisia tabaci is a species complex that causes damage to its broad range of plant hosts through serious feeding. It transmits plant viruses of different groups to important agricultural crops. Some important cash crops of Pakistan are sugar cane, rice, tobacco and seed oil. It shows high genetic variability and is differentiated as races or biotypes. Biotypes are, biotype Q, biotype B, biotype B2, biotype M, biotype L, biotype A, biotype H, biotype C, biotype K, biotype N, biotype R, biotype E, biotype P, biotype J, biotype S, biotype AN. Although the current report based on the Bayesian study of mitochondrial cytohrome oxidase gene1 (CO1) DNA sequences has classified the different populations of whiteflies into twelve genetic groups which are Mediterranean, Sub-Saharan Africa silverleafing, Indian Ocean, Asia II, Asia I, Australia, New World, Italy, China, Sub-Saharan Africa non-silverleafing, Mediterranean/Asia Minor/Africa and Uganda sweet potato. Begomoviruses is largest group of viruses transmitted by B. tabaci and cause major diseases of crops such as tomato and chili leaf curl disease, cassava mosaic disease; yellow mosaic disease of legumes and cotton leaf curl disease. The main objective of current study is to inculpate knowledge regarding genetic diversity of whitefly in cotton fields across Pakistan via analysis of partial DNA sequence of mitochondrial gene Cytochrom Oxidase I (mtCO1).

Abstract Heart and blood vessel disorders, such as coronary heart disease, brain vessel disease, rheumatic heart disease, and others, are together referred to as cardiovascular disease (CVD). In this study, we sought to determine how mitochondrial Leucine Transfer RNA genes and CVDs are related (MT-L1 and MT-L2). From CVD patients in Peshawar, a total of 27 saliva samples were taken. Leu-tRNA genes expressed by mitochondria were amplified using polymerase chain reaction after DNA was removed. Ten samples were sent for sequencing after PCR and gene cleaning. We obtained all of the sequenced results, which were subsequently aligned and evaluated against the mitochondrial revised Cambridge Reference Sequence (rCRS). However, in our sequenced samples, Leu-tRNA MT-L1 and MT-L2 genes were determined to be unaltered. Thus, it is suggested that a large population be taken into account while screening for mutations in the mitochondrial encoded Leu-tRNA MT-L1 and MT-L2 genes of cardiac patients in areas of Pakistan. Additionally, it is recommended that patients with cardiac problems should also have other mitochondrial encoded genes checked for potential mutations. This could result in the identification of genetic markers that could be used for early CVD screening in Pakistan. disorders others CVD. . (CVD) study MTL1 MTL MT L1 L (MT-L MTL2. MTL2 L2 MT-L2) Peshawar 2 LeutRNA Leu tRNA removed cleaning results rCRS. rCRS (rCRS) However MT-L unaltered Thus Pakistan Additionally (CVD (rCRS

Resumo Distúrbios do coração e dos vasos sanguíneos, como doença cardíaca coronária, doença dos vasos cerebrais, doença cardíaca reumática entre outros, são referidos juntos como doença cardiovascular (DCV). Neste estudo, procuramos determinar como os genes mitocondriais do RNA de transferência de leucina e as DCVs estão relacionados (MT-L1 e MT-L2). Foi coletado um total de 27 amostras de saliva de pacientes com DCV em Peshawar. Genes de Leu-tRNA expressos por mitocôndrias foram amplificados usando reação em cadeia da polimerase (PCR) após a remoção do DNA. Dez amostras foram enviadas para sequenciamento após PCR e limpeza gênica. Obtivemos todos os resultados sequenciados, que foram posteriormente alinhados e avaliados em comparação com a Sequência de Referência de Cambridge revisada (rCRS). No entanto, em nossas amostras sequenciadas, os genes Leu-tRNA MT-L1 e MT-L2 foram determinados como inalterados. Assim, sugere-se que uma grande população seja levada em consideração durante a triagem de mutações nos genes Leu-tRNA MT-L1 e MT-L2 mitocondriais codificados de pacientes cardíacos em áreas do Paquistão. Além disso, recomenda-se que outros genes mitocondriais codificados de pacientes com problemas cardíacos também sejam verificados quanto a possíveis mutações. Isso pode resultar na identificação de marcadores genéticos que podem ser usados para triagem precoce de DCV no Paquistão. sanguíneos coronária cerebrais DCV. . (DCV) estudo MTL1 MTL MT L1 L (MT-L MTL2. MTL2 L2 MT-L2) 2 Peshawar LeutRNA Leu tRNA (PCR DNA gênica sequenciados rCRS. rCRS (rCRS) entanto sequenciadas MT-L inalterados Assim sugerese sugere se Paquistão disso recomendase recomenda (DCV (rCRS

Silver nanoparticles (Ag-NPs) can enter tumor cells through endocytosis and transfer to mitochondria, then disrupt mitochondrial function, damage deoxyribonucleic acid (DNA), and finally lead to cell death and apoptosis. As the Ag-NPs synthesized by Moringa peregrina leaf extract contain biomolecules such as flavonoids and terpenoids, they may suppress cancer by disrupting the flow of autophagy and inhibiting the differentiation of cancer cells, especially in apoptosis-resistant cancer cells. Accordingly, the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromid (MTT) assay proved that Ag-NPs could inhibit the OVCAR-3 cell line in a timeand concentration-dependent manner. Real-time polymerase chain reaction (PCR) results showed that the ratio of the pro-apoptotic Bak1 gene to the anti-apoptotic Bclx gene increased about 10 times compared to the control. Also, the expression of the caspase-3 gene has increased about 18 times compared to the control. In addition, it was found that Ag-NPs can inhibit the progression of ovarian cancer cell lines and decrease the expression of the AKT1 gene by 0.08. And the more important point was the safety of Ag-NPs, which was checked by the lipid peroxidation method and it was confirmed that the treated hepatocytes did not have any significant difference in the production of malondialdehyde with the control and probably do not cause hepatotoxicity. AgNPs Ag NPs (Ag-NPs mitochondria function DNA, DNA , (DNA) apoptosis terpenoids apoptosisresistant resistant Accordingly 34,5dimethylthiazol2yl2,5diphenyltetrazoliumbromid 345dimethylthiazol2yl25diphenyltetrazoliumbromid dimethylthiazolyldiphenyltetrazoliumbromid 3 4,5 dimethylthiazol 2 yl 2,5 diphenyltetrazoliumbromid 4 5 MTT (MTT OVCAR3 OVCAR OVCAR- concentrationdependent concentration dependent manner Realtime Real time PCR (PCR proapoptotic pro apoptotic Bak antiapoptotic anti 1 Also caspase3 caspase caspase- addition AKT 008 0 08 0.08 AgNPs, NPs, hepatotoxicity (DNA 34 5dimethylthiazol2yl2 5diphenyltetrazoliumbromid 45 4, 25 2, 00 0.0 dimethylthiazolyl 5dimethylthiazol2yl 0.

ABSTRACT Fasciola species are the causative agents of liver fluke disease (fasciolosis) which is primarily found in domestic and wild ruminants but also are causal agents of fascioliasis in humans. Few reports for the genotyping of Fasciola species in Saudi Arabia were available. This study aimed to identify the Fasciola species infecting sheep using morphology and molecular tools. For that, livers of 500 imported sheep were slaughtered at abattoirs located in Riyadh (Saudi Arabia), and parasite species were isolated from 28 liver samples and then preserved for subsequent stages in this study. These parasite species were identified as Fasciola hepatica and Fasciolagigantica via morphology and confirmed via the 28S rRNA, ITS-1, COI, and NDI sequences with a close identity for other Fasciola species within the family Fasciolidae. Phylogenetic analysis of the obtained sequences showed that Fasciola isolates from the current study were clustered in one subclade closely related to isolates from Iran, Vietnam, Australia, South Africa, Eastern Europe, India, Egypt, Sudan, Japan, Poland, Spain, Armenia, and Turkey. A combination of data from morphology and molecular analysis could be considered a useful tool for identifying Fasciola species infecting sheep in Saudi Arabia. fasciolosis (fasciolosis humans available tools 50 Arabia, , Arabia) 2 S rRNA ITS1, ITS1 ITS 1, 1 ITS-1 COI Fasciolidae Iran Vietnam Australia Africa Europe India Egypt Sudan Japan Poland Spain Armenia Turkey 5 ITS-

RESUMO As espécies de Fasciolasãoosagentescausadores da doença da fascíolahepática (fasciolose), encontradaprincipalmenteemruminantesdomésticos e selvagens, mas tambémsãoagentescausadores da fasciolíaseemhumanos. Haviapoucosrelatos de genotipagem de espécies de FasciolanaArábiaSaudita. O objetivodesteestudofoiidentificar as espécies de Fasciola que infectamovinosusando ferramentas morfológicas e moleculares. Para isso, fígados de 500 ovelhasimportadasforamabatidosemmatadouroslocalizadosemRiad (ArábiaSaudita), e espécies de parasitasforamisoladas de 28 amostras de fígado e preservadas para as etapassubsequentesdesteestudo. Essasespécies de parasitasforamidentificadascomoFasciola hepatica e Fasciolagigantica por meio da morfologia e confirmadas por meio das sequências 28S rRNA, ITS-1, COI e NDI com umaidentidadepróximaaoutrasespécies de Fasciola dentro da famíliaFasciolidae. A análisefilogenética das sequênciasobtidasmostrou que osisolados de Fasciola do presenteestudoforamagrupadosem um subcladointimamenterelacionado a isolados do Irã, Vietnã, Austrália, África do Sul, Europa Oriental, Índia, Egito, Sudão, Japão, Polônia, Espanha, Armênia e Turquia. Uma combinação de dados de morfologia e análise molecular pode ser consideradauma ferramenta útil para identificarespécies de Fasciola que infectamovinosnaArábiaSaudita. fasciolose, fasciolose , (fasciolose) selvagens fasciolíaseemhumanos FasciolanaArábiaSaudita moleculares isso 50 ArábiaSaudita, ArábiaSaudita (ArábiaSaudita) 2 etapassubsequentesdesteestudo S rRNA ITS1, ITS1 ITS 1, 1 ITS-1 famíliaFasciolidae Irã Vietnã Austrália Sul Oriental Índia Egito Sudão Japão Polônia Espanha Turquia infectamovinosnaArábiaSaudita (fasciolose 5 (ArábiaSaudita ITS-