Abstract Resistant populations of Amaranthus palmeri to acetolactate synthase (ALS) inhibitors are present in Spain and Italy, but the evolutionary origin of resistance remains unknown. This study assesses the response of eleven populations of A. palmeri to ALS inhibitors and employs a haplotype-based genetic method to investigate the origin and distribution of resistance. All populations were resistant to thifensulfuron-methyl (THIF) and imazamox (IMA). The mutation in the Trp-574-Leu allele of the ALS gene was the primary cause of cross-resistance in both countries. Mutant alleles at 376-Glu and 197-Thr were also found in two Spanish populations. Genetic analyses revealed the presence of seven distinct haplotypes in the Spanish populations and three in the Italian ones. No haplotype was common to both countries. ALS-resistant populations were introduced to Italy and Spain from outside Europe. Their evolutionary histories differ, and the introduction events are independent. Resistance to ALS inhibitors spread over short and long distances through seed dispersal. The higher number and genetic diversity among Spanish haplotypes indicate recurrent invasions.

Resumen Poblaciones resistentes de Amaranthus palmeri a inhibidores de la acetolactato sintasa (ALS) están presentes en España e Italia, pero el origen evolutivo de la resistencia sigue siendo desconocido. En este estudio se evalúa la respuesta de once poblaciones de A. palmeri a los inhibidores de ALS, y se utiliza un método genético basado en haplotipos para estudiar origen y distribución de la resistencia. Todas las poblaciones eran resistentes a tifensulfurón-metil (THIF) y imazamox (IMA). La mutación en el alelo Trp-574-Leu del gen ALS era la causa principal de la resistencia cruzada en ambos países. En dos poblaciones españolas también se encontraron alelos mutantes en 376-Glu y 197-Thr. Los análisis genéticos revelaron la presencia de siete haplotipos distintos en las poblaciones española y dos en las italianas. Ninguno haplotipo era común a ambos países. Las poblaciones resistentes a ALS fueron introducidas en Italia y España desde fuera de Europa. Sus historias evolutivas son diferentes y los eventos de introducción son independientes. La resistencia a los inhibidores de ALS se propagó a cortas y largas distancias mediante la dispersión de semillas. El mayor número y diversidad genética entre los haplotipos españolas indican invasiones recurrentes.

Abstract Mackerel fish (Scomberomorus spp.) represents a significant marine fisheries commodity in Indonesia, characterized by its high commercial value and nutritional content. To understand the intraspecific interactions and genetic variability of Scomberomorus spp., a more extensive research of Scomberomorus spp. populations, including both cultivated and wild specimens, is required. This study aimed to explore the genetic diversity of mackerel fish in Indonesian waters, focusing on the mitochondrial DNA (mtDNA) cytochrome oxidase subunit II (COII) gene, which encodes the second subunit of cytochrome c oxidase (complex IV), is essential for aerobic respiration and energy transformation. Muscle tissue samples from 18 individual mackerel fish collected from various regions in Indonesia, including Palembang, Cilacap, Rembang, Banjarmasin, Ambon, and Fak-Fak Regencies, were utilized. The genomic DNA was isolated and amplified using specific primers: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') and CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Subsequently, the obtained amplicons were subjected to sequencing. The sequence data were then analyzed using the MEGA11 and DnaSP 6 software. Our findings revealed 120 variable sites within the 691 base pairs of mtDNA COII sequences, resulting in a nucleotide diversity (Pi) of 0.07169. Furthermore, we identified eight haplotypes, demonstrating a haplotype diversity (Hd) of 0.8889. Remarkably, all mackerel samples from Palembang and Cilacap clustered into discrete haplotypes, specifically haplotype 1 and haplotype 2, respectively. Our phylogenetic analysis delineated three distinct clades. Clade I, closely related to Scomberomorus cavalla, encompassed all individuals from Ambon, Palembang, Rembang, and one from Banjarmasin. Clade II, associated with Scomberomorus niphonius, included individuals from Cilacap and two from Banjarmasin. Clade III, linked to Scomberomorus semifasciatus, exclusively consisted of individuals from Fak-Fak (Papua). In conclusion, Indonesian waters harbor diverse genetic variations within Scomberomorus spp., and population relationships based on the mtDNA COII gene exhibit notable complexities. Future research endeavors should focus on further elucidating the diversity and relationships among Scomberomorus spp. in diverse Indonesian populations. spp Indonesia content populations specimens required (mtDNA (COII complex IV, IV , IV) transformation Rembang Banjarmasin Ambon FakFak Fak Regencies utilized primers COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Subsequently sequencing MEGA MEGA1 software 12 69 sequences Pi (Pi 007169 0 07169 0.07169 Furthermore haplotypes Hd (Hd 08889 8889 0.8889 Remarkably 2 respectively clades I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusion complexities 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0.0716 0888 888 0.888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0.071 088 88 0.88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0.07 08 8 0.8 (5'-ATGTCACTAAGGGTGGTTGG 00 0.0 0.

Resumo O peixe cavala (Scomberomorus spp.) representa uma importante commodity da pesca marinha na Indonésia, caracterizada pelo seu alto valor comercial e conteúdo nutricional. Para entender as interações intraespecíficas e a variabilidade genética do Scomberomorus spp., é necessária uma pesquisa mais ampla das populações de Scomberomorus spp. Este estudo teve como objetivo explorar a diversidade genética do peixe cavala nas águas da Indonésia, com foco no gene mitocondrial do DNA (mtDNA) da subunidade II da citocromo oxidase (COII) que codifica a segunda subunidade da citocromo c oxidase (complexo IV), essencial para a respiração aeróbica e a transformação de energia. Foram utilizadas amostras de tecido muscular de 18 peixes cavala individuais, coletados de diversas regiões da Indonésia, incluindo Palembang, Cilacap, Rembang, Banjarmasin, Ambon e Regiões de Fak-Fak. O DNA genômico foi isolado e amplificado utilizando iniciadores específicos: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') e CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Posteriormente, os amplicons obtidos foram submetidos a sequenciamento. Os dados de sequência foram então analisados usando o software MEGA 11 e DnaSP 6. Nossos resultados revelaram um total de 120 sítios variáveis dentro dos 691 pares de bases das sequências de mtDNA COII, resultando em uma diversidade de nucleotídeos (Pi) de 0,07169. Além disso, identificamos oito haplótipos distintos, demonstrando uma diversidade haplotípica (Hd) de 0,8889. Notavelmente, todas as amostras de peixe cavala de Palembang e Cilacap se agruparam em haplótipos distintos, especificamente haplótipo 1 e haplótipo 2, respectivamente. Nossa análise filogenética delineou três clados distintos. O Clado I, intimamente relacionado ao Scomberomorus cavalla, englobou todos os indivíduos de Ambon, Palembang, Rembang e um de Banjarmasin. O Clado II, associado ao Scomberomorus niphonius, incluiu indivíduos de Cilacap e dois de Banjarmasin. O Clado III, ligado ao Scomberomorus semifasciatus, consistiu exclusivamente de indivíduos de Fak-Fak (Papua). Em conclusão, as águas indonésias abrigam diversas variações genéticas dentro de Scomberomorus spp., e as relações populacionais com base no gene mtDNA COII apresentam complexidades notáveis. Futuros empreendimentos de pesquisa devem se concentrar em elucidar ainda mais a diversidade e as relações entre as populações de Scomberomorus spp. em diversas regiões da Indonésia. spp Indonésia nutricional (mtDNA (COII complexo IV, IV , IV) energia individuais Banjarmasin FakFak. FakFak Fak Fak. específicos COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Posteriormente sequenciamento 6 12 69 Pi (Pi 007169 0 07169 0,07169 disso distintos Hd (Hd 08889 8889 0,8889 Notavelmente 2 respectivamente I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusão notáveis 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0,0716 0888 888 0,888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0,071 088 88 0,88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0,07 08 8 0,8 (5'-ATGTCACTAAGGGTGGTTGG 00 0,0 0,

Resumo O gene do hormônio de crescimento (GH) desempenha um papel vital na regulação do metabolismo animal e do tamanho corporal, tornando-se um potencial candidato para influenciar o desempenho do gado. Este estudo teve como objetivo investigar os polimorfismos dentro do gene GH e suas associações com 10 características biométricas na população de gado Sumbawa da Indonésia. Dados de características biométricas e amostras de sangue foram coletados de 112 indivíduos de gado Sumbawa, e suas sequências genéticas do gene GH foram analisadas usando dois conjuntos de primers para amplificação. Sete polimorfismos de nucleotídeo único (SNPs) foram identificados no gene GH: g.442C>T, g.446G>C, g.558C>T, g.649C>A, g.1492C>A, g.1510C>A e g.1578G>A. Todos os SNPs estavam localizados na região intrônica, exceto o SNP g.558C>T, que foi encontrado na região da sequência de codificação (CDS). O SNP g.558C>T é classificado como uma variante sinônima. A análise de haplótipos revelou um forte desequilíbrio de ligação entre os SNPs g.558C>T e g.649C>A. As distribuições de genótipos e alelos de todos os SNPs estavam de acordo com o equilíbrio de Hardy-Weinberg (p > 0,05, χ2 < 15,56), exceto para os SNPs g.446G>C e g.1492C>A. O estudo de associação mostrou que o SNP g.442C>T afetou significativamente (p < 0,05) as características HL, BL, SH e PH no gado Sumbawa. Além disso, o g.446G>C e o g.558C>T também foram encontrados associados às características PH e CC, respectivamente. Os polimorfismos detectados no gene GH podem ter implicações para programas de seleção visando melhorar as características biométricas desejadas no gado Sumbawa. A melhoria da produtividade pecuária pode ser feita através da compreensão da diversidade genética e sua relação com as características fenotípicas. (GH corporal tornandose tornando se 1 Indonésia 11 amplificação (SNPs g442CT gCT g 442C T C g446GC gGC 446G G g558CT 558C g649CA gCA 649C g.649C>A g1492CA 1492C g.1492C>A g1510CA 1510C g1578GA gGA 1578G g.1578G>A intrônica CDS. CDS . (CDS) sinônima HardyWeinberg Hardy Weinberg p 005 0 05 0,05 χ 15,56, 1556 15,56 , 15 56 15,56) HL BL disso CC respectivamente fenotípicas CT GC CA GA (CDS 00 0,0 155 15,5 5 0, 15,

Abstract The growth hormone (GH) gene plays a vital role in regulating animal metabolism and body size, making it a potential candidate for influencing livestock performance. This study aimed to investigate the polymorphisms within the GH gene and their associations with 10 biometric traits in the Sumbawa cattle population of Indonesia. Biometric trait data and blood samples were collected from 112 Sumbawa cattle individuals, and their GH gene sequences were analyzed using two sets of primers for amplification. Seven single nucleotide polymorphisms (SNPs) were identified in the GH gene: g.442C>T, g.446G>C, g.558C>T, g.649C>A, g.1492C>A, g.1510C>A, and g.1578G>A. All SNPs were located in the intronic region except for SNP g.558C>T, which was found in the coding sequence (CDS) region. The SNP g.558C>T is classified as a synonymous variant. Haplotype analysis revealed a strong linkage disequilibrium between SNPs g.558C>T and g.649C>A. Distributions of genotypes and alleles of all SNPs were in agreement with the Hardy-Weinberg equilibrium (p > 0.05, χ2 < 15.56), except for SNPs g.446G>C and g.1492C>A. The association study showed that the SNP g.442C>T significantly (p < 0.05) affected HL, BL, SH, and PH traits in Sumbawa cattle. Additionally, the g.446G>C and g.558C>T were also found to be associated with PH and CC traits, respectively. The polymorphisms detected in the GH gene could have implications for selection programs to enhance desired biometric traits in Sumbawa cattle. Improving livestock productivity can be done by understanding genetic diversity and its relationship with phenotypic characteristics. (GH size performance 1 Indonesia 11 individuals amplification (SNPs g442CT gCT g 442C T C g446GC gGC 446G G g558CT 558C g649CA gCA 649C A g.649C>A g1492CA 1492C g.1492C>A g1510CA 1510C g.1510C>A g1578GA gGA 1578G g.1578G>A CDS (CDS variant HardyWeinberg Hardy Weinberg p 005 0 05 0.05 χ 15.56, 1556 15.56 , 15 56 15.56) HL BL SH Additionally respectively characteristics CT GC CA GA 00 0.0 155 15.5 5 0. 15.

Resumo O burro doméstico possui um papel fundamental como animal de tração na economia rural do Paquistão, onde a população desse animal está aumentando a cada ano. A região de controle de mtDNA completa de 40 burros amostrados aleatoriamente foi ampliada por PCR e sequenciada bidirecionalmente por intermédio de primers específicos. Haplótipos distintos de mtDNA obtidos no estudo atual (KY446001 − KY446011) foram submetidos a medidas de haplótipo (h) e diversidade de nucleotídeos (π) por meio de DnaS, bem como análises filogenéticas, de rede e AMOVA. Havia um total de 27 sítios polimórficos presentes em 11 haplótipos de mtDNA exclusivos dos 40 animais estudados de diferentes regiões. A rede de união de vizinhos e a rede de união mediana ilustram a divisão de todos esses haplótipos em duas linhagens núbias e somalis bem definidas, confirmando a origem materna africana do burro doméstico do Paquistão. Os parâmetros de diversidade h (0,967 ± 0,037) e π (0,02917 ± 0,00307) revelaram altos níveis de diversidade genética em burros paquistaneses. AMOVA demonstrou apenas 1% de diferenças genéticas entre as duas linhagens maternas de mtDNA, apontando a falta de subestrutura populacional em burros paquistaneses, como é o caso da população mundial de burros domésticos. Os burros paquistaneses têm origem materna africana e altos níveis de diversidade de mtDNA. A alta diversidade genética pode ser por causa da reprodução não seletiva e de heteroplasmia. Aqui, fornecemos o primeiro relatório sobre a diversidade do mtDNA da região de controle em burros domésticos do Paquistão.

Abstract Domestic donkey plays a key role as a draft animal in rural economy of Pakistan where its population is increasing every year. The complete mtDNA control region of forty randomly sampled donkeys was PCR- amplified and sequenced bi-directionally using specific primers. Distinct mtDNA haplotypes obtained in the current study (KY446001−KY446011) were subjected to haplotype (h) and nucleotide diversity (π) measures using DnaS as well as to phylogenetic, Network, and AMOVA analyses. There were a total 27 polymorphic sites present within 11 unique mtDNA haplotypes from the studied 40 animals from different regions. Neighbor-joining network and median-joining network both illustrated the splitting of all these haplotypes into two well-defined Nubian and Somali lineages, confirming African maternal origin of Pakistani domestic donkey. Diversity parameters h (0.967± 0.037) and π (0.02917± 0.00307) were found to reveal high levels of genetic diversity in Pakistani donkeys. AMOVA demonstrated only 1% of genetic differences between two mtDNA maternal lineages, pointing to lack of population substructure in Pakistani donkeys as is the case with worldwide domestic donkey population. Pakistani donkeys have African maternal origin and high levels of mtDNA diversity. High genetic diversity may be due to non-selective breeding and heteroplasmy. We herein provide the first report on mtDNA diversity of control region in Pakistani domestic donkey.

Resumo Ligula intestinalis é um parasita cestódeo que acomete peixes de água doce em diversos países do mundo. O presente estudo visa revelar a diversidade filogenética, genética e de haplótipos das sequências do gene mt-CO1 enviadas ao banco de dados do NCBI de diferentes países, por meio de análise in-silico. As sequências gênicas de 105 mt-CO1 (371 pb) de L. intestinalis obtidas do NCBI foram utilizadas para análises bioinformáticas. As sequências foram submetidas a análise filogenética e de haplótipos. Como resultado da análise de haplótipos de L. intestinalis, 38 haplótipos foram obtidos de 13 países diferentes. Hap24 constituiu 44,76% da rede de haplótipos obtida. Mudanças nos nucleotídeos entre os haplótipos ocorreram em 1-84 pontos diferentes. A China e a Turquia apresentam os maiores valores do índice de fixação (Fst), 0,59761, enquanto o menor (-0,10526) foi encontrado entre a Rússia e a Turquia. Este estudo fornece uma linha de base para futuros estudos em larga escala sobre epidemiologia, aspectos ecológicos, padrão de distribuição, dinâmica de transmissão e dispersão populacional de L. intestinalis em todo o mundo.

Abstract Ligula intestinalis is a cestode parasite that affects freshwater fish in different countries of the world. The current study aims to reveal the phylogenetic, genetic and haplotype diversity of mt-CO1 gene sequences sent to the NCBI database from different countries by using in-silico analysis. The 105 mt-CO1 (371 bp) gene sequences of L. intestinalis obtained from NCBI were used for bioinformatics analyses. Sequences were subjected to phylogenetic and haplotype analysis. As a result of the haplotype analysis of L. intestinalis, 38 haplotypes were obtained from 13 different countries. Hap24 constituted 44.76% of the obtained haplotype network. Changes in nucleotides between haplotypes occurred at 1-84 different points. China and Turkey have highest fixation index (Fst) values of 0.59761, while the lowest (-0.10526) was found between Russia and Turkey. This study provides a baseline for future studies on extensive scale on the epidemiology, ecological aspects, distribution pattern, transmission dynamics and population dispersion of L. intestinalis worldwide.

Resumo Muitas espécies de Cichla colonizaram com sucesso lagos e reservatórios do Brasil desde os anos 1960, causando graves prejuízos à vida selvagem nesses locais. Neste estudo, 135 tucunarés foram coletados em um complexo de reservatórios a fim de identificar se representavam uma espécie dominante ou múltiplas espécies, uma vez que diversas espécies de Cichla foram registradas na bacia. Os espécimes foram identificados com base na coloração, dados morfométricos e merísticos, e por marcadores mitocondriais COI, 16S rDNA e Região Controle (RC). A sobreposição dos dados morfométricos e o padrão similar de coloração impediram a identificação utilizando as chaves de identificação disponíveis na literatura. Entretanto, as análises bayesiana e de máxima verossimilhança de dados moleculares demonstraram a ocorrência de uma única espécie, Cichla kelberi. Um único haplótipo foi observado para o 16S e RC, enquanto três foram detectados para o COI, com um haplótipo dominante presente em 98,5% das amostras. A baixa diversidade nos exemplares introduzidos de C. kelberi evidenciou um número limitado de linhagens maternas fundadoras. O sucesso da invasão parece depender de fatores abióticos, como a maior transparência da água de ambientes lênticos que favorece predadores visuais que, atrelado à ausência de predadores, fez do C. kelberi um invasor bem-sucedido nesses reservatórios.

Abstract Several species of Cichla successfully colonized lakes and reservoirs of Brazil, since the 1960’s, causing serious damage to local wildlife. In this study, 135 peacock bass were collected in a reservoir complex in order to identify if they represented a single dominant species or multiple ones, as several Cichla species have been reported in the basin. Specimens were identified by color pattern, morphometric and meristic data, and using mitochondrial markers COI, 16S rDNA and Control Region (CR). Overlapping morphological data and similar coloration patterns prevented their identification using the taxonomic keys to species identification available in the literature. However, Bayesian and maximum likelihood from sequencing data demonstrated the occurrence of a single species, Cichla kelberi. A single haplotype was observed for the 16S and CR, while three were detected for COI, with a dominant haplotype present in 98.5% of the samples. The extreme low diversity of the transplanted C. kelberi evidenced a limited number of founding maternal lineages. The success of this colonization seems to rely mainly on abiotic factors, such as increased water transparency of lentic environments that favor visual predators that along with the absence of predators, have made C. kelberi a successful invader of these reservoirs.

Abstract Background: Members of the genus Cupiennius Simon, 1891 are categorized as wandering spiders and are part of the family Trechaleidae. The genomics and proteomics of Cupiennius spiders from North America remain uncharacterized. The present study explores for the first time molecular data from the endemic species Cupiennius chiapanensis Medina, 2006, and also presents new data for Cupiennius salei (Keyserling, 1878), both collected in southern Mexico. Methods: In total, 88 Cupiennius specimens were collected from southern Mexico and morphologically identified. DNA was extracted and the mitochondrial COI fragment was amplified. COI sequences were analyzed, and a phylogenetic tree was inferred for species from the Americas. Genetic diversity was analyzed using haplotype networks and gene distances. Venom was obtained from C. chiapanensis and C. salei by electrostimulation. The venom was separated by HPLC, visualized using SDS-PAGE, and quantified for use in toxicity bioassays in mice and insects. Results: Analysis of COI sequences from C. chiapanensis showed 94% identity with C. salei, while C. salei exhibited 94-97% identity with sequences from Central and South American conspecifics. The venom from C. chiapanensis exhibited toxic activity against crickets. Venoms from C. chiapanensis and C. salei caused death in Anastrepha obliqua flies. Analysis of venom fractions from C. salei and C. chiapanensis revealed molecular masses of a similar size as some previously reported toxins and neurotoxic components. We determined the amino acid sequences of ChiaTx1 and ChiaTx2, toxins that are reported here for the first time and which showed toxicity against mice and insects. Conclusion: Our work is the first to report COI-based DNA barcoding sequences from southern Mexican Cupiennius spiders. Compounds with toxic activity were identified in venom from both species. Background Simon 189 Trechaleidae uncharacterized Medina 2006 Keyserling, Keyserling (Keyserling 1878, 1878 , 1878) Methods total 8 amplified Americas distances C electrostimulation HPLC SDSPAGE, SDSPAGE SDS PAGE, PAGE SDS-PAGE insects Results 94 9497% 9497 97% 97 94-97 conspecifics crickets flies components ChiaTx ChiaTx2 Conclusion COIbased based 18 200 187 9 949 94-9 1 20 94- 2

Abstract Biomphalaria straminea is one of the three snails that act as the intermediate hosts of Schistosoma mansoni and is responsible for maintaining high rates of schistosomiasis in some areas of northeastern Brazil. The principal morphological characteristic of B. straminea is the marked vaginal wrinkling, although it is also present in congeneric species, a group known as the B. straminea complex. Based on the morphological and molecular analyses, we investigated the intraspecific variation of B. straminea. The specimens were obtained from 10 sites in Brazil, and the shells were analyzed, as well as 16 morphological structures of the reproductive system. The COI and ITS2 sequences were used for phylogenetic analysis, genetic divergence, and haplotype network (COI). We observed a large intraspecific variation in the morphological structures examined. The genetic divergence also demonstrated significant intraspecific variability in B. straminea: 0–3% in ITS2 sequences, and 0–6% in COI sequences. Analysis of the distribution of COI haplotypes recovered 16 haplotypes and haplotype diversity of 0.9088. These results indicate phenotypic variability that is not constrained to a locality or strictly controlled genetically by B. straminea, which may have driven a misidentified of these species. Brazil B wrinkling species complex analyses 1 analyzed system ITS analysis COI. . (COI) examined 03 0 3 0–3 06 6 0–6 09088 9088 0.9088 (COI 0– 0908 908 0.908 090 90 0.90 09 9 0.9 0.

Resumen Antecedentes: El manejo humano de las plantas puede modificar los niveles y la distribución de su diversidad genética. Preguntas: ¿Cómo es la estructura filogeográfica de Crescentia alata y cómo se asocia con cambios climáticos? ¿Qué tan diversos genéticamente son los huertos y qué impacto tiene el manejo de los árboles sobre esta diversidad? Especie de estudio: Crescentia alata Kunth (Bignoniaceae). Sitio y fechas de estudio: México y Centroamérica 2009-2011. Métodos: Se evaluaron 243 individuos de 10 poblaciones de huerto y 25 poblaciones silvestres. Se identificaron haplotipos con base en seis loci de microsatélites de cloroplasto, y sus relaciones se reconstruyeron con una red de unión de medianas. Se estimaron la diversidad haplotípica y la estructuración genética con los índices R ST , G ST y AMOVA, y se evaluó la presencia de barreras geográficas. Se evaluó la hipótesis de un crecimiento demográfico con la distribución de diferencias pareadas y se proyectó la distribución geográfica potencial al Holoceno Medio, Último Máximo Glacial y Último Inter Glacial. Resultados: Se observó un patrón latitudinal de estructura filogeográfica y se detectaron barreras geográficas en la costa norte del océano Pacífico y el Istmo de Tehuantepec. Se detectó un crecimiento demográfico, probablemente asociado a condiciones ambientales glaciales. La mayoría de los árboles de huertos son tolerados y portan haplotipos compartidos con poblaciones silvestres simpátricas. Conclusiones: El manejo humano no ha modificado la estructura filogeográfica natural de C. alata y los huertos constituyen un reservorio genético donde se favorecen procesos de introgresión mediados por propagación vía semilla.

Abstract Background: Human management of plant populations can modify the amounts and distribution of their genetic diversity. Questions: What is the phylogeographic structure of Crescentia alata and how is it related to past climatic changes? What are the genetic diversity levels of homegarden populations and how are they associated to human management? Studied species: Crescentia alata Kunth (Bignoniaceae). Study site and dates: Mexico and Central America 2009-2011. Methods: We analyzed 243 trees from 10 homegarden and 25 wild populations. Chloroplast haplotypes were identified through six microsatellite loci. Haplotype relationships were reconstructed with a median-joining network. Genetic diversity and structuring were evaluated with R ST and G ST indexes and AMOVA. Geographical barriers among populations were identified with Monmonier’s algorithm. The hypothesis of historical demographic growth was evaluated through the paired differences distribution and the species potential distribution was projected onto the past during the Middle Holocene, Last Glacial Maximum and Last Inter Glacial periods. Results: A latitudinal pattern of phylogeographic structure was identified with geographical barriers in the northern Pacific Ocean and the Tehuantepec Isthmus. We detected a significant demographic growth, likely associated to glacial environmental conditions. Most homegarden trees were found to be tolerated and share chloroplast haplotypes with sympatric wild populations. Conclusions: Human management has not modified the natural phylogeographic structure of C. alata and homegarden populations represent a genetic reservoir where introgression processes are favored by seed mediated propagation.

ABSTRACT The Cerambycidae Oncideres impluviata (Germar, 1823) is an important insect pest for Acacia mearnsii De Wild in Southern Brazil. The damage caused by their girdling behavior reduces tree productivity, specially in the early years of plant establishment, when girdling is performed on the main trunk of trees. Here, we used a fragment of the mtDNA COI gene to analyze the genetic diversity, population structure and demography of O. impluviata in Southern Brazil, as well as to present the first hypothesis of phylogenetic relationships among species of the genus Oncideres. Our results identified five distinct haplotypes among the populations of O. impluviata, with the most common haplotype identified as O.imp_COI_01. The phylogenetic inferences corroborated the monophyly of O. impluviata with maximum statistical support. In addition, the phylogeny recovered three main population strains that are largely congruent with the haplotype network, which includes two lineages that are found in different edaphic regions of Rio Grande do Sul (Serra do Sudeste and Encosta Inferior do Nordeste). This is the first molecular phylogenetic assessment of O. impluviata. Our findings provide insights into the evolution of a significant species for the Brazilian forestry sector, as well as new resources for planning of pest management strategies. Germar, Germar (Germar 1823 Brazil productivity establishment trees Here diversity O OimpCOI01 OimpCOI imp 01 O.imp_COI_01 support addition network Serra Nordeste. Nordeste . Nordeste) sector strategies 182 OimpCOI0 0 O.imp_COI_0 18 O.imp_COI_ 1 O.imp_COI

Abstract Mexico is a megadiverse region with a complex geological history, but it remains unclear to what extent the distribution of freshwater fish has been influenced by geographic barriers. This study examines the population level genetic divergence and phylogenetic relationships of species in the shortfin group of the subgenus Mollienesia (genus Poecilia), a group of live-bearing fishes that are widely distributed across Mexico, with sampling at a small geographic scale. Samples from over 50 locations were analyzed for six species by using phylogenetic and haplotype network approaches to assess genetic diversity across geographic ranges and to refine the distributions of species in this group. The results indicate that Mexican species have diversified following multiple, independent invasions from Middle America. Two species found north of the Trans-Mexican Volcanic Belt (TMVB) and one transversal species exhibited weak phylogenetic structure, likely due to the lack of physiographic barriers, recent colonization, and high dispersal rates among regions. In contrast, three species found south of the TMVB exhibited strong phylogenetic structure, reflecting a longer presence in the area and multiple physiographic barriers that isolated populations. This study identified mechanisms driving divergence and speciation, expanded the known range of several species, and resolved taxonomic uncertainties of populations. history genus Poecilia, Poecilia , Poecilia) livebearing live bearing scale 5 America TransMexican Trans (TMVB structure colonization regions contrast populations speciation

Resumen México es una región megadiversa con una historia geológica compleja, pero se desconoce el nivel de influencia de las barreras geográficas sobre las distribuciones de los peces dulceacuícolas. Este estudio examina las relaciones filogenéticas, a escala geográfica pequeña, de las especies del grupo de aletas cortas del subgénero Mollienesia (género Poecilia), un grupo de peces vivíparos ampliamente distribuidos en México. Se analizaron muestras de seis especies en más de 50 localidades, utilizando métodos filogenéticos y de redes de haplotipos, para evaluar la diversidad genética y precisar las distribuciones de especies en este grupo. Los resultados indican que las especies mexicanas se han diversificado a partir de múltiples invasiones independientes desde Mesoamérica. Se detectó estructura filogenética débil en dos especies distribuidas al norte del Eje Neovolcánico y una especie que atraviesa el Eje Neovolcánico, posiblemente debido a la ausencia de barreras fisiográficas, colonización reciente y altas tasas de dispersión entre regiones. En contraste, se detectaron niveles altos de estructura filogenética en tres especies distribuidas del Eje Neovolcánico, lo que refleja una presencia más prolongada en el área y la existencia de múltiples barreras fisiográficas que aislaron a las poblaciones. Este estudio identificó mecanismos que promueven la divergencia y la especiación, expandió el rango conocido de varias especies y resolvió incertidumbres taxonómicas de algunas poblaciones. compleja dulceacuícolas filogenéticas pequeña género Poecilia, Poecilia , Poecilia) 5 localidades haplotipos Mesoamérica regiones contraste poblaciones especiación

Abstract The South American siluriform fishes are found primarily in the Neotropical region, north and east of the Colorado River of Argentina, with a few relict species distributed southward and westward on both sides of the Andes Mountains. Three of these, the closely related trichomycterids Hatcheria macraei, Trichomycterus areolatus and Bullockia maldonadoi, have been subject to historical taxonomic and nomenclatural arrangements. Here, we amplify a 652-bp fragment of COI mtDNA from 55 H. macraei individuals and use publicly available Cytb mtDNA sequences of the three taxa to assess their relationship, genetic variation and haplotype distribution in relation to hydrographic basins. In addition, we extend a recent morphometric study on H. macraei by analyzing body shape in 447 individuals collected from 24 populations across their entire cis-Andean distribution. We identified some lineages previously assigned to T. areolatus that show a closer relationship to either B. maldonadoi or H. macraei, revealing new boundaries to their currently known trans-Andean distribution. We found a great morphologic variation among H. macraei populations and a high genetic variation in H. macraei, T. areolatus and B. maldonadoi associated with river basins. We highlight further integrative studies are needed to enhance our knowledge of the southern Andean trichomycterid diversity. region Argentina Mountains these arrangements Here 652bp bp 652 5 H basins addition 44 2 cisAndean cis T B transAndean trans diversity 65 4 6

In South Africa, the family Heliozelidae in the order Lepidoptera is restricted to four known species. The grapevine leaf miner, Holocacista capensis, feeds between the epidermal layers of a grapevine leaf, predominantly along the leaf margin. A final instar larva will descend from the blotch mine/gallery to attach its cocoon casing (constructed from the epidermal layers of the mined gallery) to any object below the infested leaf. Five monophyletic clades and a polyphyletic group have been identified within the Heliozelidae, using a mitochondrially encoded gene cytochrome c oxidase I (COI) and a nuclear gene, histone 3 (H3). An exploratory study of the genetic diversity within H. capensis populations was conducted using these genes. The phylogenetic analyses of COI indicate that H. capensis that are currently being collected from South Africa fall within three clades/haplotypes, of which one is well supported and contains only one species from Gauteng, and one has three specimens from two different areas in the Western Cape province, while 80% belong to haplotype 1 (H1). The current study can be used as a starting point for future DNA-based studies aimed at gaining insight into possible patterns of diversity in H. capensis to confirm switching from native to commercial grapevine hosts. However, more samples need to be collected from different areas in South Africa.

This study aimed to assess the genetic diversity, maternal origin, and population structure of Turkish Aseel chickens. The research was conducted on Aseel roosters and chicks older than one year. DNA was extracted from 96 Turkish Aseel feather samples collected from various regions of Türkiye for the study. Sample DNAs were amplified using specific primers for the D-loop region of the chicken mitochondrial DNA (mtDNA). The sequences were produced using the amplified DNA samples. The mtDNA D-loop regions were compared with the sequences of the same genetic area from other chicken breeds. Turkish Aseel chickens provided 34 haplotypes and 18 genuine polymorphisms across 41 distinct regions that were particular to the breed. According to the findings of the phylogenetic tree, Turkish Aseel chickens tend to establish clusters of haplogroups among themselves. Although most Turkish Aseel samples clustered individually into three clades, at least one sample has been discovered with five distinct clades. According to the phylogenetic tree and the Median Joining Network, it can be concluded that while many of the haplogroups of Turkish Aseel cluster among themselves, they have diverse maternal origins and lack breed-specific maternal lineages. This research is the first extensive study to examine genetic variability in Turkish Aseel chickens. Considering the lack of similar data on other Aseel varieties raised in different counties, the current work is a pioneering study with data on the genetic characterization of the Aseel breed.

Abstract Drosophila buzzatii (Diptera: Drosophilidae) is a fly that breeds exclusively on decaying tissues of cacti species widely distributed in tropical and subtropical areas of South America. This distribution includes biomes in distinct climatic regimes (e.g., seasonal rain forest, semi-arid scrubs, savannas, and grasslands), which at first glance could might give the false impression that the species is not sensitive to either climate or vegetation physiognomies. However, detection of historical demographic events within D. buzzatii reveal the interplay between climate and the population structure of the species as the Late Quaternary climate changes occurred. To understand this process, we performed a phylogeographic analysis based on sequences of the mitochondrial gene COI for 128 individuals from 43 localities. Our analyses combined coalescent methods, population genetics, and paleodistributions estimation methods. Our study reveals that the COI haplotype diversity is geographically structured, with a decreasing cline from north to south. The results suggest an ancient range expansion, dated from 610k to 550k years before present, in the northernmost region of the species distribution, the Caatinga vegetation. More recently, an intense gene flow and a population expansion were detected in the central and south portions of its distribution. The demographic events detected date back to the glacial periods of the Quaternary. Diptera (Diptera Drosophilidae America e.g., eg e g (e.g. forest semiarid semi arid scrubs savannas grasslands, grasslands , grasslands) physiognomies However D occurred process 12 4 localities methods genetics structured k present recently e.g. (e.g 1 e.g