ABSTRACT. Oreochromis niloticus is the most important aquacultural species worldwide. Several countries are interested in repopulating natural or artificial reservoirs with the fry of tilapia (Oreochromis sp.) to develop new fisheries or to enhance the existing ones. However, as tilapia is considered an invasive species, it is essential to check the existence of the species in the place before releasing any fry. Characterization of tilapia species with meristic is unreliable because of existing morphological similarities among species. In this work, the composition of the tilapia species of Laguna El Mastranzo (LEM), Nayarit, Mexico, was explored for the first time through a molecular method using the mitochondrial DNA control region. Three tilapia species (Oreochromis niloticus, O. aureus, and O. urolepis) were found in LEM, and it was confirmed that the two commercial strains (Aquamol and Spring) intended for repopulation were O. niloticus. Seven haplotypes of mitochondrial DNA control region sequences were obtained: three in LEM, three in Aquamol, and one in Spring strains. Before repopulating any reservoir, a molecular verification strategy is recommended to avoid spreading the species. The results of this work represent a glimpse into the genetic material of LEM, Nayarit, Mexico.

ABSTRACT Chile has a relatively long history of monitoring and managing large-scale commercial fish stocks. However, many other small-scale fisheries, particularly those operating in estuaries, usually lack basic fisheries and biological information. International experience indicates that a monitoring system designed for large-scale stocks cannot simply be resized to address the complexity, relatively low total economic value, and the large number of actors and supply chains in small-scale fisheries. This article proposes a strategy to monitor data-poor fisheries operating in estuaries. The striped mullet (Mugil cephalus), locally known as "lisa", in the Rapel River, central Chile, was selected to establish a pilot monitoring program for small-scale fish resources. From May 2022 to May 2023, fisheries information, including fleet description, catch and effort data, and fish biological attributes such as length and weight, were collected and described for the first time in the region. Drawing insights from this case study, we propose developing a generic monitoring system tailored specifically for monitoring fish stocks in estuaries. This conceptualization is based on: i) change agents, who are individuals trained to work with both the social and biological dimensions of each coastal fish stock; ii) experienced fisheries scientists outside government agencies; and iii) local fishers’ knowledge to provide constant feedback for adapting temporal and spatial scales for monitoring. This monitoring scheme is cost-effective and can be efficiently replicated in other estuarine fisheries in Chile.

Resumen: Los productos acuáticos reestructurados se procesan principalmente a partir de especies de pescado infravaloradas, recortes de filetes o subproductos de especies de pescado no comerciales. Una de las pesquerías subvaloradas en el sur de México, es la del macabil (Albula vulpes). El objetivo de este estudio fue evaluar el efecto de la adición de harinas no convencionales y la reducción del nivel de cloruro de sodio en las propiedades mecánicas y funcionales de productos reestructurados de macabil. Se elaboraron reestructurados de macabil para analizar las muestras con harina de amaranto (HA) o harina de grillo (HG) doméstico (0 %, 5 % y 10 %) y tres niveles de sal (0 %, 1 % y 2 %). Se evaluó la pérdida de agua por cocción, la cantidad de agua extraíble y la textura de los geles. El uso de ambas harinas no convencionales disminuyó la pérdida de agua por cocción entre un 49.09 % y 61.97 %, con 1 % de sal. La adición de sal redujo el agua extraíble del reestructurado. Los valores de dureza variaron (P < 0.05) entre tratamientos. La mayor dureza se obtuvo en los tratamientos con HA al 10 % y sal al 1 % (64.55 N) y con HG al 10 % y sal al 2 % (63.50 N). La cohesividad varió de 0.53 a 0.71 (adimensional) en los tratamientos con 1 % y 2 % de sal, indicando pocos cambios en la estructura interna por efecto de los aditivos. Las harinas no convencionales permitieron la gelificación proteica, formando reestructurados con propiedades texturales adecuadas para un producto cárnico. La adición del 10 % de HG común o de HA y 1 % de uso de sal, en la formulación de reestructurados de pescado, ofrece una alternativa saludable en el desarrollo de alimentos de pescado.

Abstract: Restructured seafood products are primarily processed from undervalued fish species, fillet trimmings, or byproducts of non-commercial fish species. One of the underrated fisheries in southern Mexico is that of the bonefish (Albula vulpes). The objective of this study was to evaluate the effect of adding non-conventional flours and reducing the sodium chloride level on the mechanical and functional properties of restructured bonefish products. Bonefish restructured products were prepared to analyze samples with (0 %, 5 %, and 10 %) amaranth flour (AF) or cricket flour (CF) and three levels of salt (0 %, 1 % and 2 %). The cooking water loss, the amount of extractable water and the texture from gels were evaluated. The use of both non-conventional flours reduced cooking water loss by 49.09 % to 61.97 % with 1 % salt. The addition of salt reduced the extractable water in the restructured product. Hardness values varied (P < 0.05) among treatments. The highest hardness was obtained in treatments with 10 % AF and 1 % salt (64.55 N) and with 10 % CF and 2 % salt (63.50 N). Cohesiveness ranged from 0.53 to 0.71 (dimensionless) in treatments with 1 % and 2 % salt, indicating minimal changes in internal structure due to additives. Non-conventional flours allowed for protein gelation, forming restructured products with suitable textural properties for a meat product. The addition of 10 % CF or AF and 1 % salt in fish restructured product formulation offers a healthy alternative in the development of fish-based foods.

ABSTRACT. A commercial fishery for the smooth hammerhead shark (Sphyrna zygaena) exists in the waters off northern Peru. Although international and domestic norms regulate this species, adult specimens are becoming rare. Monthly visits to four ports in the La Libertad region were made to measure S. zygaena landings and understand the present state of the fishery. We found that 92% of the specimens landed were juveniles or younger and that 10% of the original biomass remains in the fishery. This highlights that stricter regulations such as protecting breeding areas, establishing a legal catch length, and limiting the catch volume and fishing season are urgently needed to maintain a sustainable fishery.

Abstract Mackerel fish (Scomberomorus spp.) represents a significant marine fisheries commodity in Indonesia, characterized by its high commercial value and nutritional content. To understand the intraspecific interactions and genetic variability of Scomberomorus spp., a more extensive research of Scomberomorus spp. populations, including both cultivated and wild specimens, is required. This study aimed to explore the genetic diversity of mackerel fish in Indonesian waters, focusing on the mitochondrial DNA (mtDNA) cytochrome oxidase subunit II (COII) gene, which encodes the second subunit of cytochrome c oxidase (complex IV), is essential for aerobic respiration and energy transformation. Muscle tissue samples from 18 individual mackerel fish collected from various regions in Indonesia, including Palembang, Cilacap, Rembang, Banjarmasin, Ambon, and Fak-Fak Regencies, were utilized. The genomic DNA was isolated and amplified using specific primers: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') and CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Subsequently, the obtained amplicons were subjected to sequencing. The sequence data were then analyzed using the MEGA11 and DnaSP 6 software. Our findings revealed 120 variable sites within the 691 base pairs of mtDNA COII sequences, resulting in a nucleotide diversity (Pi) of 0.07169. Furthermore, we identified eight haplotypes, demonstrating a haplotype diversity (Hd) of 0.8889. Remarkably, all mackerel samples from Palembang and Cilacap clustered into discrete haplotypes, specifically haplotype 1 and haplotype 2, respectively. Our phylogenetic analysis delineated three distinct clades. Clade I, closely related to Scomberomorus cavalla, encompassed all individuals from Ambon, Palembang, Rembang, and one from Banjarmasin. Clade II, associated with Scomberomorus niphonius, included individuals from Cilacap and two from Banjarmasin. Clade III, linked to Scomberomorus semifasciatus, exclusively consisted of individuals from Fak-Fak (Papua). In conclusion, Indonesian waters harbor diverse genetic variations within Scomberomorus spp., and population relationships based on the mtDNA COII gene exhibit notable complexities. Future research endeavors should focus on further elucidating the diversity and relationships among Scomberomorus spp. in diverse Indonesian populations. spp Indonesia content populations specimens required (mtDNA (COII complex IV, IV , IV) transformation Rembang Banjarmasin Ambon FakFak Fak Regencies utilized primers COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Subsequently sequencing MEGA MEGA1 software 12 69 sequences Pi (Pi 007169 0 07169 0.07169 Furthermore haplotypes Hd (Hd 08889 8889 0.8889 Remarkably 2 respectively clades I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusion complexities 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0.0716 0888 888 0.888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0.071 088 88 0.88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0.07 08 8 0.8 (5'-ATGTCACTAAGGGTGGTTGG 00 0.0 0.

Resumo O peixe cavala (Scomberomorus spp.) representa uma importante commodity da pesca marinha na Indonésia, caracterizada pelo seu alto valor comercial e conteúdo nutricional. Para entender as interações intraespecíficas e a variabilidade genética do Scomberomorus spp., é necessária uma pesquisa mais ampla das populações de Scomberomorus spp. Este estudo teve como objetivo explorar a diversidade genética do peixe cavala nas águas da Indonésia, com foco no gene mitocondrial do DNA (mtDNA) da subunidade II da citocromo oxidase (COII) que codifica a segunda subunidade da citocromo c oxidase (complexo IV), essencial para a respiração aeróbica e a transformação de energia. Foram utilizadas amostras de tecido muscular de 18 peixes cavala individuais, coletados de diversas regiões da Indonésia, incluindo Palembang, Cilacap, Rembang, Banjarmasin, Ambon e Regiões de Fak-Fak. O DNA genômico foi isolado e amplificado utilizando iniciadores específicos: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') e CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Posteriormente, os amplicons obtidos foram submetidos a sequenciamento. Os dados de sequência foram então analisados usando o software MEGA 11 e DnaSP 6. Nossos resultados revelaram um total de 120 sítios variáveis dentro dos 691 pares de bases das sequências de mtDNA COII, resultando em uma diversidade de nucleotídeos (Pi) de 0,07169. Além disso, identificamos oito haplótipos distintos, demonstrando uma diversidade haplotípica (Hd) de 0,8889. Notavelmente, todas as amostras de peixe cavala de Palembang e Cilacap se agruparam em haplótipos distintos, especificamente haplótipo 1 e haplótipo 2, respectivamente. Nossa análise filogenética delineou três clados distintos. O Clado I, intimamente relacionado ao Scomberomorus cavalla, englobou todos os indivíduos de Ambon, Palembang, Rembang e um de Banjarmasin. O Clado II, associado ao Scomberomorus niphonius, incluiu indivíduos de Cilacap e dois de Banjarmasin. O Clado III, ligado ao Scomberomorus semifasciatus, consistiu exclusivamente de indivíduos de Fak-Fak (Papua). Em conclusão, as águas indonésias abrigam diversas variações genéticas dentro de Scomberomorus spp., e as relações populacionais com base no gene mtDNA COII apresentam complexidades notáveis. Futuros empreendimentos de pesquisa devem se concentrar em elucidar ainda mais a diversidade e as relações entre as populações de Scomberomorus spp. em diversas regiões da Indonésia. spp Indonésia nutricional (mtDNA (COII complexo IV, IV , IV) energia individuais Banjarmasin FakFak. FakFak Fak Fak. específicos COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Posteriormente sequenciamento 6 12 69 Pi (Pi 007169 0 07169 0,07169 disso distintos Hd (Hd 08889 8889 0,8889 Notavelmente 2 respectivamente I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusão notáveis 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0,0716 0888 888 0,888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0,071 088 88 0,88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0,07 08 8 0,8 (5'-ATGTCACTAAGGGTGGTTGG 00 0,0 0,

ABSTRACT: This article presents an experimental study to verify the feasibility of using the emerging UAV technology in the mapping of fishing grounds exploited by artisanal fishing in Sepetiba Bay, in the south of the state of Rio de Janeiro-Brazil, aiming to better understand the functionality and information generated by the equipment, and whether the data can help improve local fisheries management and also provide information for the implementation of simplified traceability for regional fish. The study area included four locations, Ilha da Madeira, Vila Geny, Coroa Grande and Ponte Preta, all located in Sepetiba Bay, located in the municipality of Itaguaí, in the southern region of the state of Rio de Janeiro. The aerial mapping was carried out in September, October and November 2017, between 10 am and 12 pm (GMT-3), employing a Phantom 3 Professional UAV (DJI, Shenzhen, China), Anac Brasil registration number PP-011092014. The onboard camera a DJI 4K Edition Sony Exmor R Model IMX117: 7.81mm equipped with a CMOS sensor dimension of 6.2 mm, 4000 x 3000 12 megapixel resolution, with an f/2.8 lens and field of view (FOV) of 94, having a focal length of 14mm. Images were collected perpendicularly to the main plan. Flight height was set at 80 m, flight speed was determined based on the overlap of 80%, dimension of area to be mapped, and battery life. Hence, the operator utilized a average flight speed of 25 km/h. ground sample distance (GSD) was 1.20 cm/px. and an overlap of 80% between images was established to avoid possible failures and orthomosaic information gaps. For each fishery mapped, standard software processing was carried out, which consists of: aligning the photos, creating a point cloud, creating a digital elevation model, and finally the orthomosaic itself. Once processed, the orthomosaics were exported from Agis Soft Photo Scan Professional to Google Earth (Google Inc.), where it is possible to make a more comprehensive assessment of fisheries in a much more practical and faster way. A total of four flights were carried out, one for each study area, averaging 10 minutes each. As a result, the technology proved to be viable to apply, since it made it possible to identify and map the areas defined for this research, generating data such as distance and, characteristics of the place, which could be used to track the fish caught and landed, in addition to enabling the monitoring of vessels and fishing, and thus improve the management of local fisheries. ABSTRACT Bay JaneiroBrazil, JaneiroBrazil Janeiro Brazil, Brazil Janeiro-Brazil equipment locations Madeira Geny Preta Itaguaí September 2017 1 GMT3, GMT3 GMT , (GMT-3) DJI, (DJI Shenzhen China, China China) PP011092014. PP011092014 PP 011092014. 011092014 PP-011092014 K IMX117 IMX 781mm mm 7 81mm 62 6 2 6. 400 300 resolution f28 f 8 f/2. FOV (FOV 94 14mm plan m mapped life Hence kmh km h km/h GSD (GSD 120 20 1.2 cmpx cm px cm/px gaps photos cloud model itself processed Inc., Inc Inc. Inc.) way result apply research place landed 201 (GMT-3 PP01109201 01109201 PP-01109201 IMX11 40 30 f2 f/2 9 1. (GMT- PP0110920 0110920 PP-0110920 IMX1 4 f/ (GMT PP011092 011092 PP-011092 PP01109 01109 PP-01109 PP0110 0110 PP-0110 PP011 011 PP-011 PP01 01 PP-01 PP0 0 PP-0 PP-

RESUMO: Este artigo apresenta um estudo experimental para verificar a viabilidade de uso da tecnologia emergente UAV no mapeamento dos pesqueiros explotados pela pesca artesanal na Baía de Sepetiba, no sul do estado do Rio de Janeiro-Brasil, visando conhecer melhor a funcionalidade e informações geradas pelo equipamento, e se os dados poderão auxiliar na melhoria do gerenciamento da pesca local e também subsidiar informações para a implantação de uma rastreabilidade simplificada para o pescado regional. A área de estudo contemplou quatro localidades sendo Ilha da Madeira, Vila Geny, Coroa Grande e Ponte Preta, todas inseridas na Baía de Sepetiba, localizada no município de Itaguaí, região sul do estado do Rio de Janeiro. O mapeamento aéreo foi realizado nos meses de setembro, outubro e novembro de 2017, entre 10h e 12h (GMT-3), utilizando um VANT Phantom 3 Professional (DJI, Shenzhen, China), registro Anac Brasil PP-011092014. A câmera integrada é uma DJI 4K Edition Sony Exmor R Modelo IMX117: 7,81 mm equipada com sensor CMOS de 6,2 mm, resolução 4000 x 3000 de 12 megapixels, com lente f/2.8 e campo de visão (FOV) de 94, possuindo uma distância focal de 14 mm. As imagens foram coletadas perpendicularmente ao plano principal. A altura de voo foi fixada em 80 m, a velocidade de voo foi determinada com base na sobreposição de 80%, dimensão da área a ser mapeada e duração da bateria. Assim, o operador utilizou uma velocidade média de voo de 25 km/h. a distância da amostra terrestre (GSD) foi de 1,20 cm/px. e foi estabelecida uma sobreposição de 80% entre as imagens para evitar possíveis falhas e lacunas de informações do ortomosaico. Para cada pesqueiro mapeado foi realizado o processamento padrão do software, que consiste em: alinhamento das fotos, criação da nuvem de pontos, criação de modelo de elevação digital, e finalmente o ortomosaico propriamente dito. Uma vez processado, os ortomosaicos foram exportados do Agis Soft Photo Scan Professional para o Google Earth (Google Inc.), onde é possível fazer uma avaliação mais abrangente dos pesqueiros de uma maneira muito mais prática e rápida. Foram realizados um total de quatro voos, um para cada área de estudo, com duração média de 10 minutos cada. Como resultado, a tecnologia mostrou-se viável de aplicação, uma vez que possibilitou identificar e mapear as áreas definidas para nesta pesquisa, gerando dados como distância e características do local, que poderão ser utilizados para rastrear o pescado capturado e desembarcado, além de possibilitar o monitoramento das embarcações e da pesca e assim, aprimorar o gerenciamento da pesca local. RESUMO Sepetiba JaneiroBrasil, JaneiroBrasil Janeiro Brasil, Janeiro-Brasil equipamento regional Madeira Geny Preta Itaguaí setembro 2017 h GMT3, GMT3 GMT , (GMT-3) DJI, (DJI Shenzhen China, China China) PP011092014. PP011092014 PP 011092014. 011092014 PP-011092014 K IMX117 IMX 781 7 81 7,8 62 6 2 6, 400 300 1 megapixels f28 f 8 f/2. FOV (FOV 94 principal m bateria Assim kmh km km/h GSD (GSD 120 20 1,2 cmpx cm px cm/px software fotos pontos digital dito processado Inc., Inc Inc. Inc.) rápida voos resultado mostrouse mostrou aplicação pesquisa desembarcado assim 201 (GMT-3 PP01109201 01109201 PP-01109201 IMX11 78 7, 40 30 f2 f/2 9 1, (GMT- PP0110920 0110920 PP-0110920 IMX1 4 f/ (GMT PP011092 011092 PP-011092 PP01109 01109 PP-01109 PP0110 0110 PP-0110 PP011 011 PP-011 PP01 01 PP-01 PP0 0 PP-0 PP-

Abstract The Atlantic goliath grouper Epinephelus itajara is the largest grouper species in the Atlantic Ocean. Despite the conservation status being Vulnerable (VU) globally and Critically Endangered (CR) in Brazil, the species continues to face threats from overfishing throughout its range. We used DNA barcoding employing the mitochondrial Cytochrome c oxidase subunit I (COI) gene to identify the illegal commercialization of E. itajara in fish markets from the northern (NC) and southern (SC) Brazilian coasts. Sampling was conducted in fish markets and aimed to confirm the identification of mischaracterized fish sold as E. itajara in the NC, as well as identifying fish fillets sold as the Dusky grouper in the SC. DNA barcoding allowed the unambiguous identification of 22 (84.6%) of the 26 analyzed fish market samples. Both sampled areas had confirmation of E. itajara illegal commercialization and from the 22 analyzed samples, 17 (77.3%) were confirmed to be E. itajara. Here we report two crimes, the illegal sale of E. itajara and commercial fraud by species substitution. This study has highlighted that the existing legislation that protects E. itajara in Brazilian waters requires the adoption of better public policies for the conservation of the species. Ocean VU (VU CR (CR Brazil range COI (COI E NC (NC SC (SC coasts 2 84.6% 846 84 6 (84.6% samples 1 77.3% 773 77 3 (77.3% crimes substitution 84.6 8 (84.6 77.3 7 (77.3 84. (84. 77. (77. (84 (77 (8 (7 (

Resumo O mero do Atlântico Epinephelus itajara é a maior espécie de garoupa no Oceano Atlântico. Apesar do seu status de conservação Vulnerável (VU) globalmente e Criticamente em Perigo (CR) no Brasil, a espécie continua enfrentando ameaças da sobrepesca em toda a sua área de distribuição. Utilizamos o sequenciamento de DNA por código de barras, empregando o gene mitocondrial da Citocromo c oxidase subunidade I (COI), para identificar a comercialização ilegal de E. itajara em mercados de peixe nas costas norte (CN) e sul (CS) do Brasil. A coleta de amostras foi realizada em mercados de peixe e teve como objetivo confirmar a identificação de peixes descaracterizados e vendidos como E. itajara na CN, bem como identificar filés de peixe vendidos como garoupa verdadeira na CS. O sequenciamento de DNA por código de barras permitiu a identificação inequívoca de 22 (84,6%) das 26 amostras de mercado de peixe analisadas. Ambas as áreas amostradas tiveram confirmação da comercialização ilegal de E. itajara, e das 22 amostras analisadas, 17 (77,3%) foram confirmadas como E. itajara. Nós relatamos aqui dois crimes, a venda ilegal de E. itajara e a fraude comercial por substituição de espécies. Este estudo ressaltou que a legislação existente que protege E. itajara em águas brasileiras requer a adoção de melhores políticas públicas para a conservação da espécie. VU (VU CR (CR Brasil distribuição COI, COI , (COI) E CN (CN CS (CS 2 84,6% 846 84 6 (84,6% analisadas 1 77,3% 773 77 3 (77,3% crimes espécies (COI 84,6 8 (84,6 77,3 7 (77,3 84, (84, 77, (77, (84 (77 (8 (7 (

ABSTRACT In this study, the length-weight relationships (LWRs) and length-length relationships (LLRs) of 16 marine fish species-important component of fishery production models-were estimated. The specimens were collected monthly from commercial gillnet fisheries from November 6, 2018 to October 30, 2019 in Vietnamese waters. In total, 7,426 individuals had their total length (TL), fork length (FL) and total body weight (W) measured. LWRs were calculated using the logarithmic transformation of the linear regression equation logW = loga + b*logTL, while LLRs were determined using a linear regression model: TL = a + b*FL. In addition, 95% confidence intervals (CIs) were estimated for the model parameters. The results showed that all regression parameters were highly significant (p < 0.001), with coefficients of determinations (R 2 ) > 0.9412 for all species. The a (intercept) values ranged from 0.0025 to 0.4, and the b (slope) values ranged from 2.53 to 3.28. TL and FL were highly correlated (p < 0.001 and R 2 > 0.9422 for all parameters), and a and b ranged from -9.12 to 15.85 and 0.87 to 1.45, respectively. The results provide the key morphology parameters, which are beneficial for fishery researchers and managers in stock assessment, administration and conservation. study lengthweight (LWRs lengthlength (LLRs 1 speciesimportant species important modelswere models 6 201 30 waters 7426 7 426 7,42 TL, , (TL) (FL W (W measured blogTL logTL b*logTL bFL b*FL addition 95 CIs (CIs p 0.001, 0001 0 001 0.001) 09412 9412 0.941 intercept (intercept 00025 0025 0.002 04 4 0.4 slope (slope 253 53 2.5 328 3 28 3.28 0.00 09422 9422 0.942 parameters) 9.12 912 9 12 -9.1 1585 15 85 15.8 087 87 0.8 145 45 1.45 respectively assessment conservation 20 742 42 7,4 (TL 000 00 0941 941 0.94 0002 002 0. 25 5 2. 32 3.2 0.0 0942 942 9.1 91 -9. 158 8 15. 08 14 1.4 74 7, 094 94 0.9 3. 9. -9 1. 09 -

Abstract This paper describes the fishing profile and the temporal variation in the commercial landings of elasmobranchs in a global hotspot for their conservation and investigates the variables that influenced the landings. Census data on commercial catches were obtained between April 2008 and October 2010 from nine landing sites in Bragança (Pará, northern Brazil). Five vessel types, four fishing gears, and eight fishing techniques engaged with elasmobranch capture were identified. A total of 2,357 landings were recorded, with a total production of 354 t. The highest yields were recorded in 2009, with sharks being harvested mostly by small and medium-sized vessels, and batoids, by small vessels and canoes. Drifting nets and longlines played a prominent role in elasmobranch fisheries. The results show that the landings were influenced by days at sea, which is common in tropical fisheries. The elasmobranch data series is discontinuous as statistics are absent for most fishing sites albeit imperative for proper management, as well as relevant for decision-makers focusing on their conservation. 200 201 Pará, Pará (Pará Brazil. Brazil . Brazil) types gears identified 2357 2 357 2,35 35 t 2009 mediumsized medium sized batoids canoes fisheries sea management decisionmakers decision makers 20 235 2,3 3 23 2,

Abstract The study of reproductive biology is an important tool in identifying protective measures to preserve fish stocks, providing essential data for a reliable management system that ensures a balance between the environment and the economy. This study aims to analyze the first sexual maturity and type of spawning of the fish Conodon nobilis (Linnaeus, 1758) on the Amazon coast, specifically in the Gulf Maranhense region. 360 specimens were obtained from commercial fishing activity in the community of Raposa-MA during the period from January to December 2021. Biometric data were recorded, and the gonadal maturation stages were determined through macro (maturation scale) and microscopic (histology) analyzes. Sex ratio, mean length of first sexual maturation and type of spawning were determined. Negative allometric growth was recorded for both sexes, indicating a greater increase in length than in weight, and the length varied from 11 to 31.8 cm and the sex ratio was 1 male:1.5 female. Individuals in all stages of maturation were observed throughout the year, with a predominance of individuals in spawning capacity and reproductive peaks in January, April and May, indicating that the species presents multiple spawning. The length at first sexual maturity (L50) for females was 18.41 cm and for males was 18.91 cm. Knowledge of the mean size at sexual maturity can help define appropriate regulations for fishing, ensuring that individuals have the opportunity to reproduce at least once before being captured. stocks economy Linnaeus, Linnaeus (Linnaeus 1758 coast region 36 RaposaMA Raposa MA 2021 scale histology (histology analyzes sexes weight 318 31 8 31. male1.5 male15 male 1.5 5 male:1. female year May L50 L (L50 1841 18 41 18.4 1891 91 18.9 captured 175 3 202 male1 male1. 15 1. male:1 L5 (L5 184 4 18. 189 9 17 20 male: (L 2

Resumo O estudo da biologia reprodutiva é uma abordagem importante na identificação de medidas de proteção para preservar os estoques pesqueiros, fornecendo dados essenciais para um sistema de gestão confiável que garanta o equilíbrio entre o meio ambiente e a economia. Neste estudo objetivou-se analisar a primeira maturidade sexual e o tipo de desova do peixe Conodon nobilis (Linnaeus, 1758) na costa amazônica, especificamente na região do Golfão Maranhense. Foram obtidos 360 exemplares provenientes da atividade de pesca comercial na comunidade pesqueira de Raposa-MA durante o período de janeiro a dezembro de 2021. Foram registrados dados biométricos e determinados os estágios de maturação gonadal por meio de análises macroscópicas (escala de maturação) e microscópicas (histologia). Foram determinados a razão sexual, a duração média da primeira maturação sexual e o tipo de desova. Foi registrado crescimento alométrico negativo para ambos os sexos, indicando maior aumento no comprimento do que no peso, sendo que o comprimento variou de 11 a 31.8 cm e a proporção sexual foi de 1 macho:1.5 fêmea. Foram observados indivíduos em todos os estágios de maturação durante todo o ano, com predomínio de indivíduos em capacidade reprodutiva e picos reprodutivos em janeiro, abril e maio, indicando que a espécie apresenta desovas múltiplas. O comprimento na primeira maturidade sexual (L50) para as fêmeas foi de 18.41 cm e para os machos foi de 18.91 cm. O conhecimento do tamanho médio na maturidade sexual pode ajudar a definir regulamentos apropriados para a pesca, garantindo que os indivíduos tenham a oportunidade de se reproduzir pelo menos uma vez antes de serem capturados. pesqueiros economia objetivouse objetivou Linnaeus, Linnaeus (Linnaeus 1758 amazônica Maranhense 36 RaposaMA Raposa MA 2021 escala histologia. histologia . (histologia) sexos peso 318 31 8 31. macho1.5 macho15 macho 1.5 5 macho:1. fêmea ano maio múltiplas L50 L (L50 1841 18 41 18.4 1891 91 18.9 capturados 175 3 202 (histologia macho1 macho1. 15 1. macho:1 L5 (L5 184 4 18. 189 9 17 20 macho: (L 2

Abstract The technological development of tools that enable the spawning of different native species is paramount to enable ex situ conservation initiatives, as well as providing means for commercial hatchery of threatened fish which, in turn, relieve fisheries pressure over wild stocks. Neotropical migratory freshwater fish depend on hormonal induction for spawning in hatcheries, through expensive methods of limited efficiency. Salminus brasiliensis is one of the largest Neotropical freshwater fish, a piscivorous top-predator, prized in angling, highly valued in the market, and appreciated in gastronomy. Teleost fish have either, two or three GnRH paralogous genes: GnRH1, GnRH2 and the GnRH3. The expression products of these paralogous isoforms consist of a larger prepro-GnRH polypeptide, which undergoes post-translational proteolytic processing to yield the active decapeptide hormone. There is increasing interest in characterizing and understanding these neuropeptides, because of its practical application in hatchery spawning. We present the characterization of GnRH1’s coding sequence for the prepro-GnRH1 polypeptide of S. brasiliensis. An annotation from a genomic assembly was used for searching for GnRH paralogues, based on data from anonymous predicted transcripts. The sequence retrieved for GnRH1 was then used as a query for searching the uncharacterized GnRH paralogues from full genomes of Characiformes deposited at NCBI. The S. brasiliensis GnRH1 gene sequence retrieved was targeted for PCR and submitted to Sanger sequencing, allowing for its confirmation. It spans 423 bp (exon 1: 128 bp; intron: 161 bp; and exon 2: 1134 bp), with open reading frames coding for 264 and 88 amino acids, respectively. The different variants retrieved for the prepro-GnRH (1, 2 and 3) from Characiformes genomes and deposited sequences from NCBI grouped in three distinct clades in a neighbor joining tree, each forming a monophyletic branch and with the S. brasiliensis sequences nested within the expected groups. Here we observed a variation at a proteolytic site (GKR→GRR), reported as highly conserved in vertebrates up to now, that can potentially alter the cleavage site and modify the peptide topology. This work has characterized, for the first time, the sequence of the GnRH1 coding for its prepro-GnRH peptide, for a member of the Charaficormes order. This will help to promote research and development of tools for broodstock spawning and environmental management of S. brasiliensis and related migratory fish. initiatives turn stocks hatcheries efficiency toppredator, toppredator top predator, predator top-predator angling market gastronomy either genes GnRH3 preproGnRH prepro posttranslational post translational hormone neuropeptides GnRH1s GnRHs s preproGnRH1 S transcripts sequencing confirmation 42 1 12 intron 16 113 bp, , bp) 26 8 acids respectively 1, (1 3 tree groups GKR→GRR, GKRGRR GKR→GRR GKR GRR (GKR→GRR) now topology characterized time order 4 11 ( (GKR→GRR

Resumo O desenvolvimento tecnológico de ferramentas que possibilitem a reprodução de diferentes espécies nativas é fundamental para viabilizar iniciativas de conservação ex situ, bem como fornecer meios para produção comercial de peixes ameaçados que, por sua vez, aliviam a pressão pesqueira sobre os estoques selvagens. Peixes migratórios de água doce Neotropicais dependem de indução hormonal para desova em pisciculturas, com métodos caros e de eficiência limitada. Salminus brasiliensis é um dos maiores peixes de água doce Neotropicais, predador de topo piscívoro, admirado na pesca esportiva, muito valorizado no mercado e apreciado na gastronomia. O hormônio liberador de gonadotrofina (GnRH) é uma molécula-chave na reprodução em todos os vertebrados. Os peixes teleósteos possuem dois ou três genes parálogos de GnRH: GnRH1, GnRH2 e GnRH3. Os produtos de expressão gênica dessas isoformas parálogas consistem em um polipeptídeo maior, pré-pró-GnRH, que sofre processamento proteolítico pós-traducional para produzir o hormônio decapeptídeo ativo. Há um interesse crescente na caracterização e compreensão desses neuropeptídeos, devido à sua aplicação prática na reprodução em pisciculturas. Aqui apresentamos a caracterização da sequência codificadora de GnRH1 para o polipeptídeo pré-pŕo-GnRH1 de S. brasiliensis. Uma anotação de montagem genômica foi usada para procurar parálogos de GnRH, com base em dados de transcritos anônimos preditos em um arquivo de anotação gênica. A sequência recuperada para GnRH1 foi então usada como argumento de busca para procura de parálogos não caracterizados de GnRH, a partir de genomas completos de Characiformes depositados no NCBI. A sequência recuperada de S. brasiliensis do gene GnRH1 foi alvo de PCR e submetida ao sequenciamento Sanger, permitindo a sua confirmação. Esta abrange 423 pb (éxon 1: 128 pb; íntron: 161 pb; éxon 2: 134 pb), com janelas abertas de leitura que codificam para 264 e 88 aminoácidos, respectivamente. As diferentes variantes do pré-pró-GnRH (1, 2 e 3) recuperadas dos genomas completos e sequências depositadas de Characiformes no NCBI agruparam-se em três clados distintos, numa árvore de neighbour joining, cada um formando um ramo monofilético e com as sequências de S. brasiliensis aninhadas dentro dos grupos esperados. Aqui observamos uma variação em um sítio proteolítico (GKR→GRR), até então relatado como altamente conservado em vertebrados, que pode potencialmente alterar o sítio de clivagem e modificar a topologia do peptídeo. Este trabalho caracteriza, pela primeira vez, a sequência do gene GnRH1 que codifica para o peptídeo pré-pró-GnRH1, para um membro da ordem Characiformes. Isto ajudará a promover a pesquisa e o desenvolvimento de ferramentas para a reprodução em piscicultura e a gestão ambiental de S. brasiliensis e outros peixes migratórios relacionados. situ vez selvagens pisciculturas limitada piscívoro esportiva gastronomia GnRH (GnRH moléculachave molécula chave vertebrados GnRH3 maior prépróGnRH, prépróGnRH pré pró póstraducional pós traducional ativo neuropeptídeos prépŕoGnRH1 prépŕoGnRH pŕo pré-pŕo-GnRH S Sanger confirmação 42 1 12 íntron 16 13 pb, , pb) 26 8 aminoácidos respectivamente 1, (1 3 agruparamse agruparam se distintos joining esperados GKR→GRR, GKRGRR GKR→GRR GKR GRR (GKR→GRR) caracteriza prépróGnRH1, prépróGnRH1 pré-pró-GnRH1 relacionados 4 ( (GKR→GRR

Resumen Introducción: El pargo mancha es un pez marino de alto consumo e interés comercial en Costa Rica que está sometido a una fuerte presión pesquera, la cual puede afectar la diversidad genética y generar problemas por depresión endogámica. Objetivo: Evaluar el estado genético de la población de Lutjanus guttatus mediante el uso microsatélites. Métodos: Se recolectaron muestras entre el 2018 y 2019 y se estudiaron 44 individuos de cada una de las localidades del Golfo de Nicoya y Golfo Dulce. Se realizó la extracción de ADN y la amplificación de diez loci con microsatélites mediante PCR, para la determinación del genotipo, análisis de diversidad genética y estructura poblacional. Resultados: Los parámetros de diversidad indican un elevado polimorfismo asociado con un alto número de alelos obtenidos por locus, pero con bajos niveles de heterocigosidad observada en comparación con la esperada (Ho= 0.774 y 0.800 y He= 0.948 y 0.954 para Golfo de Nicoya y Golfo Dulce, respectivamente). No hay evidencia suficiente para decir que las dos poblaciones son distintas (FST= 0.00264, P > 0.05). La desviación del Equilibrio de Hardy-Weinberg indica la posible mezcla de organismos de origen distinto a los del medio silvestre. Conclusiones: L. guttatus tiene niveles altos de diversidad genética, no hay evidencia de diferenciación en subpoblaciones genéticas, lo que en manejo pesquerías se considera una sola población panmíctica. La posible mezcla de individuos de origen distinto al silvestre sugiere la presencia de organismos de un programa de repoblación o de cultivos comerciales en la región. El uso de marcadores genéticos se recomienda para el monitoreo, además, en programas de repoblación y evaluar su efecto.

Abstract Introduction: The spotted snapper is a high-consumption and commercially important marine fish in Costa Rica, subjected to heavy fishing pressures, which can affect genetic diversity and generate problems due to inbreeding depression. Objective: To evaluate the genetic status of the population of Lutjanus guttatus using microsatellites. Methods: Samples were collected between 2018 and 2019, and 44 individuals from each of the localities of the Gulf of Nicoya and the Gulf of Dulce were studied. DNA extraction and amplification of ten loci with microsatellites using PCR were performed, followed by genotyping, analysis of genetic diversity, and population structure. Results: Diversity parameters indicate a high polymorphism associated with a high number of alleles obtained per locus, but with low levels of observed heterozygosity compared to expected (Ho= 0.774 and 0.800, and He= 0.948 and 0.954 for the Gulf of Nicoya and Gulf of Dulce, respectively). There is not enough evidence to say that the two populations are distinct (FST= 0.00264, P > 0.05). Deviation from Hardy-Weinberg equilibrium was recorded, indicating possible mixing of organisms of different origin from the wild environment. Conclusions: L. guttatus presents high levels of genetic diversity, without evidence of differentiation in genetic subpopulations. For fisheries management purposes, they would be considered a single panmictic population. The possible mixing with wild individuals suggests the presence of organisms derived from a restocking or commercial cultivation program carried out in the region. The use of genetic markers is recommended to maintain monitoring, follow up on restocking programs and evaluate their effect.

Resumen Introducción. Las actividades pesqueras generan un volumen de desechos relacionados con el procesamiento de especies (vísceras, cabezas y espinas), los descartes de la fauna acompañante, especies de bajo valor comercial y pérdidas relacionadas con problemas de manejo. La producción de harina de pescado es el proceso más común para recuperar los nutrientes de los subproductos del procesamiento del pescado. Sin embargo, aquellos lugares con infraestructura reducida o donde el volumen de residuos producidos no justifique la ecuación económica para la conversión en harina o aceite de pescado, el ensilaje biológico podría ser la tecnología de elección para promover una gestión sostenible de los residuos. Objetivo. Recopilar, organizar y resumir la literatura relacionada con la fermentación biológica de residuos de pescado y sus aplicaciones. Desarrollo. Se realizó una revisión bibliográfica (enero 1994 – diciembre 2020) referida al aprovechamiento integral de los residuos de la pesca, principalmente focalizada a la utilización de las bacterias ácidos lácticas en la biofermentación de los mismos. La información se organizó en diferentes secciones: ensilado de pescado, bacterias acido lácticas, fuentes de hidratos de carbono referidas a la elaboración de ensilados biológicos de pescado. Conclusiones. Los estudios analizados destacan la posibilidad de utilizar una amplia variedad de fuentes de hidratos de carbono, iniciadores biológicos y condiciones de fermentación de desechos de pescado. Los resultados satisfactorios muestran el potencial uso de los desechos de pescado en diferentes aplicaciones. Este trabajo podría aportar a las pesquerías que quieran adoptar esta tecnología para el tratamiento adecuado de los residuos con la finalidad de contribuir a la bioeconomía de reciclaje.

Abstract Introduction. Different fishing activities generate a waste volume related to the processing species (viscera, heads and bones), the discards of the companion fauna, species of low commercial value and the losses related to handling problems. Fish meal production is the most common process for recovery nutrients from these fish processing byproducts. However, those places with reduced infrastructure or where the volume of wastes produced do not justified the economic equation for conversion into fish meal or oil, the biological silage could be the technology of choice to promote a sustainable waste management. Objective. To compilate, organize and summarize literature related to biological fermentation of fish waste and its applications. Development. A bibliographic review was carried out (January 1994 - December 2020) referring to the comprehensive use of fishing residues mainly focused on the use of lactic acid bacteria in fish waste fermentation. The information was organized in different sections: fish silage, lactic acid bacteria and carbohydrate sources for biological silage. Conclusions. The studies analyzed in this review highlight the possibility of using a wide variety of carbohydrate sources, biological starters and fish waste fermentation conditions. The satisfactory results show the potential use of fish waste in different applications. This work could contribute to the fisheries that decide to adopt this kind technology in order to provide an innovative and viable recycling bioeconomy.

ABSTRACT The piramutaba, Brachyplatystoma vaillantii is a freshwater catfish that is the most abundant fishery resource in the Amazon estuary. Piramutaba trawling is done on industrial fishing scale and is characterized by the presence of many freshwater and marine bycatch species, with and without commercial value. Here we describe the bycatch of the industrial fishery of piramutaba in the Amazon estuary and evaluate the relationship of two important environmental factors, depth and salinity, with the accidental capture of freshwater and marine fishes in the Amazon estuary in the rainy and dry seasons. We identified 21 cartilaginous fish species (19.1% freshwater and 80.9% marine) and 125 bony fish species (25.6% freshwater and 74.4% marine). The bycatch included 64 species without commercial value (43% of all bycatch species), which are always discarded. Freshwater and estuarine fishes exhibited significantly higher abundances in shallower environments, while marine fishes were similarly abundant along the entire depth gradient. On the contrary, the abundance of freshwater fishes significantly decreased, and that of estuarine and marine fishes significantly increased with increasing salinity. Regarding the conservation status of the bycatch species, one is classified as vulnerable (VU), and seven as critically endangered (CR). The information on the bycatch of piramutaba fishery in the Amazon estuary is important to subsidize regional fisheries policies and the management of protected areas. factors salinity seasons 2 19.1% 191 19 1 (19.1 809 80 9 80.9 12 25.6% 256 25 6 (25.6 744 74 4 74.4 marine. . 43% 43 (43 , species) discarded environments gradient contrary decreased VU, VU (VU) CR. CR (CR) areas 19.1 (19. 8 80. 25.6 (25. 7 74. (4 (VU (CR 19. (19 25. (25 ( (1 (2

RESUMO A piramutaba, Brachyplatystoma vaillantii é um bagre de água doce que representa o recurso pesqueiro mais abundante no estuário amazônico. O arrasto da piramutaba é feito em escala industrial, caracterizado pela presença de muitas espécies de água doce e marinha capturadas de forma incidental, com e sem valor comercial. Aqui descrevemos a captura incidental da pesca industrial de piramutaba no estuário amazônico e avaliamos a relação de dois fatores ambientais, profundidade e salinidade, com a captura incidental de espécies de água doce e marinhas nas estações chuvosa e seca. Identificamos 21 espécies de peixes cartilaginosos (19,1% de água doce e 80,9% marinhos) e 125 espécies de peixes ósseos (25,6% de água doce e 74,4% marinhos). A captura incidental incluiu 64 espécies sem valor comercial (43% de todas as espécies capturadas) que sempre são descartadas. Os peixes de água doce e estuarinos exibiram abundâncias significativamente maiores em ambientes mais rasos, enquanto os peixes marinhos foram igualmente abundantes ao longo de todo o gradiente de profundidade. Inversamente, a abundância de peixes de água doce diminuiu significativamente, e a de peixes estuarinos e marinhos aumentou significativamente em salinidades maiores. Em relação ao estado de conservação das espécies capturadas, uma é reconhecida como vulnerável (VU) e sete como criticamente ameaçadas (CR). As informações sobre a captura incidental da pesca da piramutaba no estuário amazônico são fundaentais para subsidiar políticas pesqueiras regionais e gestão de áreas protegidas. ambientais salinidade seca 2 19,1% 191 19 1 (19,1 809 80 9 80,9 12 25,6% 256 25 6 (25,6 744 74 4 74,4 marinhos. . 43% 43 (43 descartadas rasos Inversamente VU (VU CR. CR (CR) protegidas 19,1 (19, 8 80, 25,6 (25, 7 74, (4 (CR 19, (19 25, (25 ( (1 (2

Abstract Amazonian commercial fishing is artisanal, and landings can be influenced by the flood pulse, the consumer market, the level of exploitation of species, habitat quality and vegetation cover. In this study, landscape variables and the river level were evaluated as possible drivers in the composition of catches landed in three regions of the Solimões-Amazon River. Fish landing data were collected in the upper and lower Solimões River and lower Amazon River. Fishing locations were mapped with information from fishers, civil defense departments and from the literature. Information related to river level and landscape was acquired from databases available online. Maps with the the radius of action of the fishing fleet and the quantification of landscape variables were made for periods of high and low-water, and non-metric multidimensional scaling analysis (nMDS) with catches by species, by region and hydrological period were performed. The largest operating radius of the fishing fleet was of 1,028 km and was identified in the lower Amazon River, which is probably due to the larger size of the consumer market, vessel characteristics and level of exploitation of the species near the landing center. The proportion of vegetation cover was reduced from 87% in the upper stretches of the Solimões River to 46% in the lower stretches. The upper and lower Solimões River regions presented a greater variety of species in the composition of landings. It was identified that the composition of landings between the three analyzed regions possibly varied according to the availability of habitats, indicating the importance of landscape variables for fish landings. artisanal pulse market study SolimõesAmazon fishers literature online lowwater, lowwater low water, water low-water nonmetric non metric nMDS (nMDS performed 1028 1 028 1,02 center 87 46 habitats 102 02 1,0 8 4 10 0 1,

Resumo A pesca comercial amazônica é artesanal e os desembarques podem ser influenciados pelo pulso de inundação, mercado consumidor, nível de explotação das espécies, qualidade do hábitat e cobertura da vegetação. Nesse estudo, avaliamos as variáveis da paisagem e o nível do rio como possíveis impulsionadores na composição das capturas desembarcadas em três regiões do rio Solimões-Amazonas. Os dados de desembarque de pescado foram coletados no Alto e Baixo rio Solimões e Baixo rio Amazonas. Os locais de pesca foram mapeados com informações dos pescadores, da defesa civil e literatura. As informações relacionadas ao nível do rio e a paisagem foram adquiridas em bancos de dados disponíveis online. Mapas com o raio de atuação da frota pesqueira e a quantificação das variáveis da paisagem foram elaborados para períodos de águas altas e baixas e as análises de escalonamento multidimensional não-métrico (nMDS) com as capturas por espécie, por região e período hidrológico foram realizadas. O maior raio de atuação da frota pesqueira foi de 1.028 km e foi identificado no Baixo rio Amazonas provavelmente devido ao maior tamanho do mercado consumidor, características das embarcações e nível de explotação das espécies próximo do centro de desembarque. A proporção de cobertura de vegetação teve uma redução de 87% no trecho superior do rio Solimões para 46% no trecho inferior. As regiões do Alto e Baixo rio Solimões apresentaram maior variedade de espécies na composição dos desembarques. Foi identificada que a composição dos desembarques entre as três regiões analisadas variou possivelmente conforme a disponibilidade de hábitats, indicando a importância das variáveis da paisagem para os desembarques de pescado. inundação consumidor estudo SolimõesAmazonas. SolimõesAmazonas Solimões-Amazonas pescadores literatura online nãométrico não métrico nMDS (nMDS espécie realizadas 1028 1 028 1.02 87 46 inferior hábitats 102 02 1.0 8 4 10 0 1.