Abstract (Introduction): Bycatch and discards are a socio-environmental concern that threatens the sustainability of marine life and fishing grounds. Approaches to this problem have focused on biological and/or ecological aspects. We considered it necessary to explore the problem from the social dimension and for this purpose we explored social representations. (Objective): The aim of this study is to explore the social representations of bycatch and discards in a group of businessmen and workers in the capture stage of the Argentine industrial fishing activity. We ask how they evaluate bycatch and fishing discards, what are their causes and if they observe possible solutions. (Methodology): Within the framework of a project of the Federal Fishing Council, we conducted focus groups with businessmen, business chambers, SOMU workers and captains of the industrial fishing activity. (Results): The results of the focus groups conducted in 2021 reveal three main causes of this problem. First, the lack of reliable data on actual discard levels raises concerns about sustainability and overfishing. Second, the low utilization of selectivity devices is attributed to their operational inefficiency and possible labour barriers. Finally, economic and organizational pressures, such as company profitability and workers’ salaries, justify the discard of non-target species, exacerbating the problem. (Conclusions): The work contributes to an understanding of the main reasons for bycatch and discards, which is essential to advance solutions. We understand that solutions are not simple and involve a sincere debate among stakeholders.

Resumen (Introducción): Las capturas incidentales y los descartes pesqueros son una preocupación socioambiental que amenaza la sostenibilidad de la vida marina y de los caladeros. Los abordajes a esta problemática estuvieron centrados en aspectos biológicos y ecológicos. Consideramos necesario explorar la problemática desde la dimensión social y para ello, exploramos las representaciones sociales. (Objetivo): El objetivo de este estudio fue explorar las representaciones sobre capturas incidentales y descartes pesqueros en un grupo de empresarios y trabajadores de la etapa de captura de la actividad pesquera industrial argentina, específicamente, cómo evalúan este problema, sus causas y posibles soluciones. (Metodología): En el marco de un proyecto del Consejo Federal Pesquero, se realizaron grupos focales con seis cámaras empresariales y personal jerárquico de empresas asociadas, así como trabajadores del SOMU y capitanes que operan en alta mar. (Resultados): Los resultados de los grupos focales realizados en 2021 revelaron tres principales causas de dicha problemática. Primero, la falta de datos confiables sobre los niveles reales de descarte genera preocupaciones sobre la sostenibilidad y la sobreexplotación. Segundo, la escasa utilización de dispositivos de selectividad se atribuye a su ineficacia operativa y a posibles barreras laborales. Finalmente, las presiones económicas y organizacionales, como la rentabilidad de las empresas y los salarios de los trabajadores, justifican el descarte, exacerbando el problema. (Conclusiones): El trabajo aporta a un entendimiento sobre las razones de la captura incidental y los descarte, esencial para avanzar en soluciones. Entendemos que las soluciones no son simples e implican un sincero debate entre actores.

Abstract Introduction: Coryphaena hippurus is a species of commercial interest with a high migratory capacity, a characteristic that places it in tropical and subtropical environments, preferring areas with a temperature range between 21 and 30 °C and salinity close to 31 ppt. Although the population trend of C. hippurus is stable, the fishing of this resource is increasing and occupies important positions in the economy of the Eastern Tropical Pacific coastal countries, which demonstrates the need to design and strengthen conservation strategies for the adequate use of this resource. Given its location in tropical and subtropical environments, its availability and distribution could be affected by climate change. Objective: To analyze the current and future potential distribution of C. hippurus under climate change scenarios. Methods: Ten algorithms were used to model the potential distribution and current habitat suitability index of C. hippurus as a function of sea surface temperature, current salinity and velocity, and these results were then projected under the most extreme climate change scenario. Results: There were good performances with all the algorithms used, but the model generated with BIOCLIM (AUC: 0.89) was chosen because it also solves the problem of spatial and temporal bias found in the records of the species. The region of greatest habitat suitability for C. hippurus matches the oceanic fronts of the Eastern Tropical Pacific. Under future conditions of extreme climate change, the species distribution pattern indicates a contraction, relocation, and expansion of habitat south of the equator. Conclusions: Under conditions of extreme climate change, the distribution model for C. hippurus suggests a process of topicalization of marine ecosystems in the Eastern Tropical Pacific by 2100.

Resumen Introducción: Coryphaena hippurus es una especie migratoria de interés comercial, que se encuentra en ambientes tropicales y subtropicales, prefiriendo zonas con un rango de temperatura entre 21 y 30 °C y salinidad cercana a 31 ppt. Aunque la tendencia poblacional del dorado es estable, la pesquería de este recurso está aumentando y ocupa importantes posiciones en la economía de países costeros del Pacífico Oriental Tropical, evidenciándose la necesidad de diseñar y fortalecer estrategias de conservación y mejorar el aprovechamiento de este recurso. Dada su ubicación en ambientes tropicales y subtropicales, la disponibilidad y distribución de este recurso podría verse afectado a futuro por el cambio climático. Objetivo: Analizar la distribución potencial actual y futura de C. hippurus bajo condiciones de cambio climático. Métodos: Se emplearon 10 algoritmos para modelar la distribución potencial e idoneidad de hábitat actual para C. hippurus a partir de la temperatura superficial del mar, la salinidad y velocidad de las corrientes, posteriormente se proyectaron estos resultados según el escenario de cambio climático más extremo. Resultados: Hubo buenos desempeños con todos los algoritmos empleados, pero se escogió el modelo generado con BIOCLIM (AUC: 0.89) pues además resuelve el inconveniente del sesgo espacial y temporal hallado en los registros de la especie. La región de mayor idoneidad de hábitat para C. hippurus coincide con los frentes oceánicos del Pacífico Oriental Tropical. En condiciones futuras de cambio climático extremo, el modelo de distribución de la especie indica una contracción, reubicación y expansión de hábitat hacia el sur de la línea ecuatorial. Conclusiones: En condiciones de cambio climático extremo, el modelo de distribución para C. hippurus sugiere un proceso de tropicalización de los ecosistemas marinos en el Pacífico Oriental Tropical para el año 2100.

The number of people on Earth and human activities are currently taking on frightening proportions with far-reaching consequences for our planet, its biodiversity and ultimately the human race itself. Ten thousand years ago, humans represented 1% of the total biomass of all land vertebrates. The rest was made up by wild animals. Currently, humans, livestock and pets make up 99% of terrestrial vertebrate biomass, while wild animals represent only 1%. It took millennia for the human population to reach the 1 billion mark and that only by 1890. By 1960, however, the world population had grown to 3 billion. Today there are 8 billion people living on our planet. According to Population Matters, the world population will be approximately 10,4 billion by the end of this century, despite the gradual decline in the growth rate in some countries. There is only a 23% chance that the total population growth rate will tail off before 2100. The population of the 47 least developed countries is likely to triple between 2017 and 2100 to around 3 billion. There are currently 62 million people in South Africa. About 67,9% of our population (in 2021) live in urban areas. The South African population grew by 0,87% in 2023. The fertility rate is 2,30 (2023). It is estimated that by 2050 75,5 million people will be living in South Africa, with 8 out of every 10 people living in urban areas, which would significantly increase the pressure on infrastructure. The Global Footprint Network states that humans currently use the resources of 1,75 Earths. If the situation does not improve, by 2050 we would need the equivalent of three Earths to survive. More than 4 billion people will have little or no water by 2050, and South Africa even now has been classified as a "water-stressed" country. Medical science is continually contributing to more babies surviving their entry into the world and to our living increasingly longer. Life expectancy has risen from 46 years in 1950 to 73,2 years in 2023. By 2050 it will be 77 years. What can be done? Empowerment of women is important. Population growth can be curbed to a reasonable extent by giving more girls access to education. This certainly does not mean that girls or women alone should be held responsible for the current population growth, but much more will have to be done about sex education, women's rights will have to be actively promoted and there will have to be better provision and use of contraceptives. Obviously, these issues should be approached and handled with due caution. In this regard, countries such as Thailand and South Korea have, in the recent past, proved that good education may result in lower birth rates. In Africa, women with no education have an average of 5,4 children; women who completed high school an average of 2,7 children and women with tertiary education an average of 2.2. In Nigeria, every year of school attendance by girls cuts the birth rate by a tenth. In addition, intensified efforts to reform economies and societies should be considered. For the sake of the survival of the human species and the sustainability of the Earth, ecological and economic justice and the empowerment ofwomen have to be encouraged. The Millennium Project - a global participatory think tank that was founded in 1996 under the auspices of the American Council for the United Nations University, but which became independent in 2009 and has since grown into a global network of institutions and individuals - aims to improve humankind's prospects for a better future. It recommends, among other things, the following: • Support a policy aimed at improving the survival of children, responsible family planning and educational opportunities for (especially) girls. • Improve methods that will ensure skills and employment opportunities for young people, as well as care and services for the elderly. • Implement the UN's urban agenda. • Create enough smart cities where citizens with urban intelligence can help in eco-smart ways with the necessary improvements in the city. • Increase training in resilience, and improve disaster prediction and management. • Provide guidance for people about urban ecology. • Intensify research and development in saltwater agriculture (halophytes or salt plants) on coastlines to produce food for humans and animals, biofuel and pulp for the paper industry, and to absorb carbon dioxide (CO2). This will ease the pressure on freshwater agriculture. • Improve agricultural and irrigation management. • Invest in precision agriculture and aquaculture. • Reduce food losses from the "farm to the mouth" (one third or 1,3 billion tons of agricultural production is wasted in this way every year). • Establish seaweed to restore wild fish populations along coastlines. The World Bank estimates that 90% of marine life is completely depleted. • Expand the production of insects for animal feed and human diets (insects have a low environmental impact, and 2 billion people already supplement their diet with insects today). • Encourage vegetarianism. Although there are more ways to address these important global challenges, responsible family planning remains one of the most important. This is an extremely sensitive issue for many people (especially in Africa), but if it is not promoted in a humane, informed and responsible way, the sustainability of life on our planet will increasingly come under tremendous pressure in various respects.

Die aantal mense op aarde en hulle/ons aktiwiteite neem tans skrikwekkende afmetings aan met wydlopende gevolge vir ons planeet, biodiversiteit en uiteindelik onsself. Die moderne mens het sy teenwoordigheid op die aarde en die benutting van hulpbronne baie lank as sy onaantasbare reg gesien. Die huidige uitwerking van byvoorbeeld bevolkingsgroei en besoedeling versteur die aarde se natuurlike ritme in so 'n mate dat ons nou nie meer op 'n kitsoplossing kan hoop nie. Die mens se getalle neem teen so 'n tempo toe dat dit nie net nadelig vir die planeet is nie, maar ook vir die mensdom self. Wat kan gedoen word? Bemagtiging van vroue speel 'n belangrike rol. Dit beteken beslis nie dat meisies en vroue alleen vir die huidige bevolkingsgroei verantwoordelik gehou moet word nie. Die bevolkingsgroei kan egter in 'n redelike mate vertraag word deur veral meer meisies toegang tot onderwys en opleiding te gee - asook hul lewensomstandighede te verbeter. Ook sal daar heelwat meer aan seksopvoeding gedoen moet word, vroueregte sal daadwerklik bevorder moet word en daar sal beter voorsiening en gebruik van voorbehoedmiddels moet wees. Uiteraard moet hierdie kwessies met die nodige omsigtigheid benader en hanteer word. In hierdie verband kan onder andere Thailand en Suid-Korea genoem word wat in die onlangse verlede bewys het dat goeie onderwys geboortesyfers laat daal. In Afrika het vroue wat geen onderwys ontvang nie, gemiddeld 5,4 kinders; vroue wat hoërskool voltooi het gemiddeld 2,7 kinders en vroue wat tersiêre studie deurloop het, gemiddeld 2,2 kinders. In Nigerië sny elke jaar wat meisies skool bywoon, die geboortesyfer met 'n tiende. Hiermee saam sal daar ook verskerpte pogings moet wees om ekonomieë en samelewings te hervorm. Ter wille van die mens se voortbestaan en die volhoubaarheid van lewe op aarde moet ekologiese en ekonomiese geregtigheid, en die bemagtiging van vroue aangemoedig word.

ABSTRACT Marine diatoms are important part of the diet of mollusks, crustaceans and fish because of their nutritional profile. The objective of this study was to evaluate the nutritional profile of eight strains of microalgae of the genera Chaetoceros and Skeletonema, dominant in the central coast of Peru, in order to rate their potential as an ingredient for aquaculture. For this, 7 L cultures were carried out at a pH of 7.5-8.5, at 17 °C, illumination of 35 µmol.s-1.m-2 and a photoperiod of 12:12 hours. After 15 days of culture, the dry biomass was obtained by lyophilization and the nutritional profile analyzes were performed. The results show values of moisture from 5 to 14 %, ash from 19 to 57 %, carbohydrates from 2 to 23 %, lipids from 3 to 9 %, and proteins from 12 to 30 %. The strain with the highest percentage of the last two compounds was that corresponding to S. costatum (IMP-BG-466). Likewise, all the strains presented high relative percentages of the essential fatty acid, eicopentaenoic acid (EPA), from 13 to 30 % and the essential amino acid leucine from 1 to 3 % (% w/w). However, as this strain presents low concentrations of docosahexaenoic acid (DHA), arginine, histidine and lysine, it is necessary to supplement it with other sources for the formulation of balanced diets.

RESUMEN Las diatomeas marinas forman parte importante de la dieta de moluscos, crustáceos y peces debido a su perfil nutricional. El objetivo de esta investigación fue evaluar el perfil nutricional de ocho cepas de microalgas de los géneros Chaetoceros y Skeletonema, dominantes en la costa central del Perú, y valorar su potencial como ingrediente para acuicultura. Se realizaron cultivos de 7 L a pH de 7.5-8.5, a 17 °C, iluminación de 35 µmol.s-1.m-2 y fotoperiodo 12:12 horas. Luego de 15 días de cultivo, se obtuvo la biomasa seca mediante liofilización y se realizaron los análisis de perfil nutricional. Los resultados indican valores de humedad de 5 a 14 %, cenizas de 19 a 57 %, carbohidratos de 2 a 23 %, lípidos de 3 a 9 % y proteínas de 12 a 30 %. La cepa con mayor porcentaje de estos dos últimos compuestos fue la correspondiente a la especie S. costatum (IMP-BG-466). Así mismo, todas las cepas presentaron altos porcentajes relativos del ácido graso esencial, ácido eicopentaenoico (EPA), de 13 a 30 % y el aminoácido esencial leucina de 1 a 3 % (% p/p). Sin embargo, al presentar bajas concentraciones del ácido docosahexaenoico (DHA), arginina, histidina y lisina, es necesario complementar su utilización con otras fuentes para la formulación de dietas equilibradas.

ABSTRACT This study aimed to evaluate the use of microalgae meal (Aurantiochytrium sp. and Nannochloropsis spp.) as a substitute for fish oil in the diet of shrimp Penaeus vannamei reared in a clear water system. In the diet of these animals, the concentration of fish oil decreased as microalgae meal was inserted, and these were used in five different substitutions: 0, 25, 50, 75, and 100%. The treatments were carried out in triplicate, and after 49 days of cultivation, the zootechnical parameters and the composition of fatty acids in the animals’ muscles were analyzed. In zootechnical performance, the shrimp obtained an average final weight of 16.59 ± 0.3 g, and the growth was approximately 1.89 ± 0.30 g week−1. In addition, feed conversion was, on average, 1.47 ± 0.28, and survival was greater than 97%. However, no significant difference was observed in these parameters. Regardless of the levels of fish oil replacement by microalgae meal, the composition of fatty acids in the shrimp muscle was ensured, as well as their quantity within groups, such as n-3 and n-6 polyunsaturated fatty acids. Thus, with the results obtained in the present study, it is suggested that it is possible to formulate a high-performance diet without any ingredients of marine origin (fish oil or fish meal), contributing to aquaculture's sustainability.

Abstract This work presents the first results obtained from developing an experimental program that aims to generate a local frame of reference for the fatty acid profiles of the main resources available in the lower basin of the Colorado river (Buenos Aires district). In this case, the purpose was to identify the fatty acid composition of fish resources and evaluate the main transformations they underwent during cooking. Replicas of archaeological vessels were made, marine fish of different species (sea catfish, whitemouth croaker, narrownose smooth-hound, conger eel, and whiting) were boiled, and the fatty acids of the raw and cooked meat, the cooking liquid, and those of the contents on the internal walls of the vessels were measured. The results obtained showed that fatty acids could be detected in all samples. However, if those identified in the raw meat of each species are compared with those detected after boiling, it is observed that the cooking event generated the loss and/or degradation of some fatty acids, mainly unsaturated ones. Fatty acids (e.g., stearic, palmitic, and oleic acid) present in most food resources (e.g., herbivores and vegetables) were preserved in the vessels. However, fatty acids detected in the vessels such as the polyunsaturated belonging to the C20 group of sea catfish and whitemouth croaker, the eicosenoic acid of sea catfish, and the monounsaturated of the C22 group identified for the conger eel could be considered diagnostic fatty acids of marine fish.

Resumen En este trabajo se presentan los primeros resultados obtenidos del desarrollo de un programa experimental que tiene como objetivo generar un marco de referencia local de los perfiles de ácidos grasos de los principales recursos disponibles en el curso inferior del río Colorado (Pcia. de Buenos Aires). En este caso, el propósito fue conocer la composición de ácidos grasos de recursos ictícolas y evaluar las principales transformaciones que estos sufren durante la cocción. Para ello, se confeccionaron réplicas de vasijas arqueológicas, se hirvieron peces marinos de distintas especies (bagre de mar, corvina rubia, gatuzo, congrio y pescadilla) y se analizaron los ácidos grasos de la carne cruda y cocida, del líquido de cocción y de los contenidos en las paredes internas de las vasijas. Los resultados obtenidos evidenciaron que en todas las muestras de peces se pudieron detectar ácidos grasos. Sin embargo, si se comparan los identificados en la carne cruda de cada especie con los detectados con posterioridad al hervido, se observa que el evento de cocción generó la pérdida y/o degradación de algunos de ellos, principalmente de los ácidos insaturados. En las vasijas se preservaron los ácidos grasos (e.g., ácido esteárico, palmítico y oleico) que comúnmente están presentes en la mayoría de los recursos alimenticios (e.g., herbívoros, vegetales). No obstante, los ácidos grasos detectados en las vasijas como los poliinsaturados pertenecientes al grupo C20 de bagre de mar y corvina rubia, el ácido eicosenoico de bagre de mar y el monoinsaturado del grupo C22 identificado para el congrio podrían ser considerados ácidos grasos diagnósticos de peces marinos.

Abstract Species of the genus Anisakis (Nematoda: Anisakidae) are indirect life-cycle marine parasites. Planktonic crustaceans serve as first intermediate hosts, while fish and cephalopods as second intermediate or paratenic hosts, and finally the cycle is completed in cetaceans, marine mammals that are the main definitive hosts of the genus. In the life cycle, Anisakis larvae can be ingested by humans as accidental hosts, which can cause anisakiasis, a zoonosis acquired through the consumption of raw or marinated fish and cephalopods. These nematodes have a cosmopolitan distribution; however, their diversity has been poorly studied in the southern hemisphere. Therefore, diversity of Anisakis spp. larvae present in two host species in Chile was evaluated by combining morphometric and genetic analysis. For this purpose, Anisakis spp. larvae were collected from the abdominal cavity of hake Merluccius gayi and the Humboldt squid Dosidicus gigas from fishing ports in the Biobío Region, Chile. Morphometric characterization of Anisakis spp. larvae consisted of measuring the length of the esophagus, esophageal ventricle, tail, total length and maximum body width. The nuclear ITS (ITS1- ITS2) and mitochondrial COX2 molecular regions were used for genetic analysis. Morphometric results revealed that Anisakis larvae extracted from D. gigas were significantly longer than those collected from M. gayi, suggesting high host-dependent phenotypic variability. Molecular and phylogenetic analyses determined the presence of Anisakis pegreffii in both host, however, demonstrated low genetic differentiation and nucleotide diversity among sequences, indicating low genetic variability for the data set. This work constitutes the first molecular record of A. pegreffii in intermediate / paratenic hosts from the coast of Chile.

Resumen Las especies del género Anisakis (Nematoda: Anisakidae) son parásitos marinos con ciclo de vida indirecto. Los crustáceos planctónicos intervienen como primeros hospedadores intermediarios, mientras que peces y cefalópodos intervienen como segundos hospedadores intermediarios o paraténicos, finalmente el ciclo se cierra en los cetáceos, mamíferos marinos que son los principales hospedadores definitivos del género. En el ciclo de vida, las larvas de Anisakis pueden ser ingeridas por el hombre interviniendo como huésped accidental, lo que puede ocasionar anisakiasis, una zoonosis adquirida a través del consumo de peces y cefalópodos crudos o marinados. Estos nemátodos tienen una distribución cosmopolita, sin embargo, su diversidad ha sido escasamente estudiada en el hemisferio Sur. Por tanto, se evaluó la diversidad de las larvas de Anisakis spp., presentes en dos especies de hospederos de Chile, combinando el análisis morfométrico y genético. Para ello, se recolectaron larvas de Anisakis spp. en la cavidad abdominal de la merluza Merluccius gayi y el calamar de Humboldt Dosidicus gigas, procedentes de terminales pesqueros de la región del Biobío, Chile. La caracterización morfométrica de las larvas de Anisakis spp., consistió en la medición de la longitud del esófago, ventrículo esofágico, cola, longitud total y ancho máximo del cuerpo. Para los análisis genéticos se usó la región molecular nuclear ITS (ITS1-ITS2) y mitocondrial COX2. Los resultados morfométricos revelaron que las larvas de Anisakis extraídas de D. gigas fueron significativamente de mayor longitud que las recolectadas en M. gayi, sugiriendo una alta variabilidad fenotípica hospedador-dependiente. Los análisis moleculares y filogenéticos determinaron la presencia de Anisakis pegreffii en ambos hospedadores, sin embargo, demostraron una baja diferenciación genética y diversidad nucleotídica entre las secuencias, indicando una escasa variabilidad genética para el conjunto de datos. Este trabajo constituye el primer registro molecular de A. pegreffii en hospedadores intermediario o paraténicos de la costa de Chile.

Abstract Salmon farming in the face of antimicrobial resistance and effects on human health and environment. Abstract: The present review compiles and analyzes studies of the last five years on antibiotic use in the salmon industry, reported effects on fish and humans, and impacts on the environment. There is a growing concern regarding the current management of veterinary therapeutic plans used for the treatment and control of bacterial infections. The main problems are related to the increase of resistance to antibiotics by pathogenic and non-pathogenic bacteria communities, horizontal transfer of resistance genes between bacterial cells, and a major number of cases of failed medical treatments in human and animal populations. Therefore, the challenges for the future will be to reduce dependence on antibiotics in animal production through research into alternatives technologies, the collection of epidemiological information from productive sectors that allow detailed monitoring in the different cultivation phases, biosafety measures from an approach of One Health, and strict supervision in the formulation of medicines by professionals in the animal area.

Resumen La salmonicultura frente a la resistencia de los antimicrobianos y los efectos sobre la salud humana y medio ambiente. Resumen: La presente revisión recopila y analiza estudios de los últimos 5 años sobre uso de antimicrobianos en la industria del salmón, efectos reportados en peces y seres humanos, y los impactos sobre el medio ambiente. Existe una creciente preocupación respecto al manejo actual de los planes terapéuticos veterinarios empleados para el tratamiento y control de infecciones bacterianas. Las principales problemáticas están relacionadas con el aumento en la resistencia hacia antimicrobianos por parte comunidades bacterianas patógenas y no patógenas, la transferencia horizontal de genes de resistencia entre células bacterianas y, un mayor número de casos de tratamientos médicos fallidos en poblaciones humanas y animales. Por lo tanto, los desafíos a futuro serán reducir la dependencia hacia los antimicrobianos en producciones animales mediante la investigación de tecnologías alternativas, la recopilación de información epidemiológica de sectores productivos que permitan realizar monitoreo detallado en las diferentes fases de cultivo, medidas de bioseguridad desde un enfoque de “One Health” y, una supervisión estricta en la formulación de medicamentos por parte de los profesionales en el área animal.

Abstract The presence of microplastics in aquatic environments has raised concerns about their abundance and potential hazards to aquatic organisms. This review provides insight into the problem that may be of alarm for freshwater fish. Plastic pollution is not confined to marine ecosystems; freshwater also comprises plastic bits, as the most of plastic fragments enter oceans via rivers. Microplastics (MPs) can be consumed by fish and accumulated due to their size and poor biodegradability. Furthermore, it has the potential to enter the food chain and cause health problems. Evidence of MPs s ingestion has been reported in >150 fish species from both freshwater and marine systems. However, microplastic quantification and toxicity in freshwater ecosystems have been underestimated, ignored, and not reported as much as compared to the marine ecosystem. However, their abundance, influence, and toxicity in freshwater biota are not less than in marine ecosystems. The interaction of MPs with freshwater fish, as well as the risk of human consumption, remains a mystery. Nevertheless, our knowledge of the impacts of MPs on freshwater fish is still very limited. This study detailed the status of the toxicity of MPs in freshwater fish. This review will add to our understanding of the ecotoxicology of microplastics on freshwater fish and give subsequent research directions. organisms bits rivers (MPs biodegradability Furthermore problems 150 >15 systems However underestimated ignored ecosystem influence consumption mystery Nevertheless limited directions 15 >1 1 >

Resumo A presença de microplásticos em ambientes aquáticos levantou preocupações sobre sua abundância e perigos potenciais para os organismos que vivem nesse meio. Esta revisão fornece informações sobre o problema que pode ser alarmante para os peixes de água doce. A poluição plástica não se limita aos ecossistemas marinhos; a água doce também contém pedaços de plástico, já que a maioria dos fragmentos de plástico entra nos oceanos por meio dos rios. Os microplásticos (MPs) podem ser consumidos pelos peixes e acumulados devido ao seu tamanho e baixa biodegradabilidade. Além disso, tem o potencial de entrar na cadeia alimentar e causar problemas de saúde. Evidências de ingestão de MPs foram relatadas em mais de 150 espécies de peixes de sistemas de água doce e marinhos. No entanto, a quantificação e a toxicidade de microplásticos em ecossistemas de água doce foram subestimadas, ignoradas e não relatadas tanto quanto em comparação com o ecossistema marinho. No entanto, sua abundância, influência e toxicidade na biota de água doce não são menores que nos ecossistemas marinhos. A interação de MPs com peixes de água doce, bem como o risco de consumo humano, permanece um mistério. Todavia, nosso conhecimento sobre os impactos das MPs em peixes de água doce ainda é muito limitado. Este estudo detalhou o status da toxicidade de MPs em peixes de água doce. Esta revisão aumentará nossa compreensão da ecotoxicologia de microplásticos em peixes de água doce e fornecerá direções de pesquisa subsequentes. marinhos rios (MPs biodegradabilidade disso saúde 15 entanto subestimadas marinho humano mistério Todavia limitado subsequentes 1

Abstract Mackerel fish (Scomberomorus spp.) represents a significant marine fisheries commodity in Indonesia, characterized by its high commercial value and nutritional content. To understand the intraspecific interactions and genetic variability of Scomberomorus spp., a more extensive research of Scomberomorus spp. populations, including both cultivated and wild specimens, is required. This study aimed to explore the genetic diversity of mackerel fish in Indonesian waters, focusing on the mitochondrial DNA (mtDNA) cytochrome oxidase subunit II (COII) gene, which encodes the second subunit of cytochrome c oxidase (complex IV), is essential for aerobic respiration and energy transformation. Muscle tissue samples from 18 individual mackerel fish collected from various regions in Indonesia, including Palembang, Cilacap, Rembang, Banjarmasin, Ambon, and Fak-Fak Regencies, were utilized. The genomic DNA was isolated and amplified using specific primers: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') and CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Subsequently, the obtained amplicons were subjected to sequencing. The sequence data were then analyzed using the MEGA11 and DnaSP 6 software. Our findings revealed 120 variable sites within the 691 base pairs of mtDNA COII sequences, resulting in a nucleotide diversity (Pi) of 0.07169. Furthermore, we identified eight haplotypes, demonstrating a haplotype diversity (Hd) of 0.8889. Remarkably, all mackerel samples from Palembang and Cilacap clustered into discrete haplotypes, specifically haplotype 1 and haplotype 2, respectively. Our phylogenetic analysis delineated three distinct clades. Clade I, closely related to Scomberomorus cavalla, encompassed all individuals from Ambon, Palembang, Rembang, and one from Banjarmasin. Clade II, associated with Scomberomorus niphonius, included individuals from Cilacap and two from Banjarmasin. Clade III, linked to Scomberomorus semifasciatus, exclusively consisted of individuals from Fak-Fak (Papua). In conclusion, Indonesian waters harbor diverse genetic variations within Scomberomorus spp., and population relationships based on the mtDNA COII gene exhibit notable complexities. Future research endeavors should focus on further elucidating the diversity and relationships among Scomberomorus spp. in diverse Indonesian populations. spp Indonesia content populations specimens required (mtDNA (COII complex IV, IV , IV) transformation Rembang Banjarmasin Ambon FakFak Fak Regencies utilized primers COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Subsequently sequencing MEGA MEGA1 software 12 69 sequences Pi (Pi 007169 0 07169 0.07169 Furthermore haplotypes Hd (Hd 08889 8889 0.8889 Remarkably 2 respectively clades I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusion complexities 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0.0716 0888 888 0.888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0.071 088 88 0.88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0.07 08 8 0.8 (5'-ATGTCACTAAGGGTGGTTGG 00 0.0 0.

Resumo O peixe cavala (Scomberomorus spp.) representa uma importante commodity da pesca marinha na Indonésia, caracterizada pelo seu alto valor comercial e conteúdo nutricional. Para entender as interações intraespecíficas e a variabilidade genética do Scomberomorus spp., é necessária uma pesquisa mais ampla das populações de Scomberomorus spp. Este estudo teve como objetivo explorar a diversidade genética do peixe cavala nas águas da Indonésia, com foco no gene mitocondrial do DNA (mtDNA) da subunidade II da citocromo oxidase (COII) que codifica a segunda subunidade da citocromo c oxidase (complexo IV), essencial para a respiração aeróbica e a transformação de energia. Foram utilizadas amostras de tecido muscular de 18 peixes cavala individuais, coletados de diversas regiões da Indonésia, incluindo Palembang, Cilacap, Rembang, Banjarmasin, Ambon e Regiões de Fak-Fak. O DNA genômico foi isolado e amplificado utilizando iniciadores específicos: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') e CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Posteriormente, os amplicons obtidos foram submetidos a sequenciamento. Os dados de sequência foram então analisados usando o software MEGA 11 e DnaSP 6. Nossos resultados revelaram um total de 120 sítios variáveis dentro dos 691 pares de bases das sequências de mtDNA COII, resultando em uma diversidade de nucleotídeos (Pi) de 0,07169. Além disso, identificamos oito haplótipos distintos, demonstrando uma diversidade haplotípica (Hd) de 0,8889. Notavelmente, todas as amostras de peixe cavala de Palembang e Cilacap se agruparam em haplótipos distintos, especificamente haplótipo 1 e haplótipo 2, respectivamente. Nossa análise filogenética delineou três clados distintos. O Clado I, intimamente relacionado ao Scomberomorus cavalla, englobou todos os indivíduos de Ambon, Palembang, Rembang e um de Banjarmasin. O Clado II, associado ao Scomberomorus niphonius, incluiu indivíduos de Cilacap e dois de Banjarmasin. O Clado III, ligado ao Scomberomorus semifasciatus, consistiu exclusivamente de indivíduos de Fak-Fak (Papua). Em conclusão, as águas indonésias abrigam diversas variações genéticas dentro de Scomberomorus spp., e as relações populacionais com base no gene mtDNA COII apresentam complexidades notáveis. Futuros empreendimentos de pesquisa devem se concentrar em elucidar ainda mais a diversidade e as relações entre as populações de Scomberomorus spp. em diversas regiões da Indonésia. spp Indonésia nutricional (mtDNA (COII complexo IV, IV , IV) energia individuais Banjarmasin FakFak. FakFak Fak Fak. específicos COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Posteriormente sequenciamento 6 12 69 Pi (Pi 007169 0 07169 0,07169 disso distintos Hd (Hd 08889 8889 0,8889 Notavelmente 2 respectivamente I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusão notáveis 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0,0716 0888 888 0,888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0,071 088 88 0,88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0,07 08 8 0,8 (5'-ATGTCACTAAGGGTGGTTGG 00 0,0 0,

Abstract Diseases in fish due to helminth parasites, especially Philometra species, are the primary worry in aquaculture. Philometra are responsible for health problem in fishes they directly affect fish growth and population parameters. A comprehensive survey was conducted involving the examination of the marine fish species Terapon jarbua, gathered from the coastal waters of Sindh, Pakistan In this research different Philometra species from marine fish Terapon jarbua during 2021 and 2022. Philometra nematodes, belonging to the family Philometridae, are common parasitic organisms inhabiting both marine and freshwater environments. Their prevalence, particularly when existing in high numbers within host organisms, can lead to severe and potentially lethal consequences. Employing light microscopy techniques, diverse species of Philometra were identified, including Philometra teraponi, P. jarbuai, P. arabiai, P. karachii, and P. awarii, localized primarily within the ovaries of the host fish. A total of 140 fish samples were examined and 76 were infected. The intensity of infected fish was 54.28%. The identification process encompassed meticulous analysis of crucial parameters, such as body size, esophagus length, positioning of the nerve ring, dimensions of the ventriculus, and ligament size. Intriguingly, the parasites were found in varying contexts; while some were free within the ovaries, others were embedded within tissues, inducing severe muscular dystrophy. This research presents novel findings of Philometra nematodes in the marine waters of Pakistan, extending their host and geographical distribution records. Future studies are needed to better evaluate and describe the dynamics and the epidemiology of Philometra infection in wild and cultured fish species aquaculture parameters Sindh 202 2022 Philometridae environments prevalence consequences techniques identified teraponi P jarbuai arabiai karachii awarii 14 7 5428 54 28 54.28% size length ring ventriculus Intriguingly contexts tissues dystrophy records 20 1 542 5 2 54.28 54.2 54.

Resumo Doenças em peixes causadas por parasitas helmintos, especialmente espécies de Philometra, são a principal preocupação na aquicultura. Philometra é responsável por problemas de saúde em peixes, pois afeta diretamente o crescimento destes e os parâmetros populacionais. Foi realizada uma pesquisa abrangente envolvendo o exame das espécies de peixes marinhos Terapon jarbua, coletadas nas águas costeiras de Sindh, Paquistão. Nesta pesquisa, foram identificadas diferentes espécies de Philometra em peixes marinhos Terapon jarbua durante 2021 e 2022. Nematoides Philometra, pertencentes à família Philometridae, são organismos parasitas comuns que habitam ambientes marinhos e de água doce. A sua prevalência, especialmente quando existe em grande número nos organismos hospedeiros, pode levar a consequências graves e potencialmente letais. Empregando técnicas de microscopia óptica, diversas espécies de Philometra foram identificadas, incluindo Philometra teraponi, P. jarbuai, P. arabiai, P. karachii e P. awarii, localizadas principalmente nos ovários do peixe hospedeiro. Um total de 140 amostras de peixes foram examinadas e 76 foram infectadas. A intensidade de peixes infectados foi de 54,28%. O processo de identificação envolveu análise meticulosa de parâmetros cruciais, como tamanho corporal, comprimento do esôfago, posicionamento do anel nervoso, dimensões do ventrículo e tamanho do ligamento. Curiosamente, os parasitas foram encontrados em contextos variados; enquanto alguns estavam livres nos ovários, outros estavam incorporados nos tecidos, induzindo distrofia muscular grave. Esta pesquisa apresenta novas descobertas de nematoides Philometra nas águas marinhas do Paquistão, ampliando seus registros de hospedeiros e distribuição geográfica. Estudos futuros são necessários para melhor avaliar e descrever a dinâmica e a epidemiologia da infecção por Philometra em espécies de peixes selvagens e cultivadas helmintos aquicultura populacionais Sindh Paquistão 202 2022 Philometridae doce prevalência letais óptica teraponi P jarbuai arabiai awarii hospedeiro 14 7 infectadas 5428 54 28 54,28% cruciais corporal esôfago nervoso ligamento Curiosamente variados tecidos grave geográfica 20 1 542 5 2 54,28 54,2 54,

Abstract Current analysis were performed to investigate the activity of various digestive enzymes, such as lipases, proteases and amylases in gut and their relationship to the other morphometric variables in a wild marine fish, Terapon jarbua. The descriptive data of the studied traits included fish weight, fish total length, gut weight, gut length, relative gut length, relative gut mass, Fulton’s condition factor, standard length and Zihler’s index. Gut length showed positive correlation with fish total length and gut weight, relative gut length (RGL) showed positive correlation with gut length. Relative gut mass (RGM) also showed positive correlation with total length (TL), gut weight (GW) and gut length (GL). Fulton’s condition factor showed positive correlation with fish weight, while negative correlation with fish total length and relative gut mass. Standard length displayed positive correlation with gut weight and gut length while, it showed negative correlation with Fulton’s factor. Zihler’s Index displayed positive correlation with gut length, RGL and Zihler’s RGM while, while showed negative correlation with Fulton’s factor and fish weight. Lipase showed negative correlation with gut weight. Amylase and protease activity have no correlation with other studied traits. Lipase activity displayed negative significant correlation with gut weight. Lipase activity showed significantly negative effect on gut-weight. Amylase activity on y-axis (PC2) contributed 13% in variation but not significantly correlated with first two principal components. It showed non-significant negative correlation with fish weight, fish length and Fulton’s factor while positive but not-significant correlation with other traits. Protease has positive and non-significant correlation with fish weight, RGL, Fulton’s factor, lipase and amylase while non-significant negative correlation with all other traits. enzymes lipases jarbua Fultons Fulton s Zihlers Zihler index (RGL (RGM TL, TL , (TL) GW (GW GL. GL . (GL) gutweight. gutweight gut-weight yaxis y axis PC2 PC (PC2 13 components nonsignificant non notsignificant (TL (GL (PC 1

Resumo No presente estudo, as análises atuais foram realizadas para investigar a atividade de várias enzimas digestivas, como lipases, proteases e amilases no intestino e sua relação com as outras variáveis morfométricas em um peixe marinho selvagem denominado “Terapon jarbua”. Os dados descritivos das características estudadas incluíram o peso e o comprimento total do peixe, o peso e o comprimento do intestino, o comprimento e a massa relativos do intestino, o fator de condição de Fulton, o comprimento padrão e o índice de Zihler. O comprimento do intestino apresentou correlação positiva com o comprimento total e o peso do intestino dos peixes, o comprimento relativo do intestino (RGL) mostrou correlação positiva com o comprimento do intestino. A massa relativa do intestino (RGM) também apresentou correlação positiva com comprimento total (TL), peso do intestino (GW) e comprimento do intestino (CG). O fator de condição de Fulton apresentou correlação positiva com o peso do peixe, enquanto correlação negativa com o comprimento total do peixe e a massa relativa do intestino. O comprimento padrão apresentou correlação positiva com o peso e o comprimento do intestino, enquanto apresentou correlação negativa com o fator de Fulton. O índice de Zihler apresentou correlação positiva com o comprimento do intestino, RGL e RGM de Zihler, enquanto apresentou correlação negativa com o fator de Fulton e o peso do peixe. A lipase mostrou correlação negativa com o peso do intestino. A atividade de amilase e protease não tem correlação com outras características estudadas. Já a atividade da lipase apresentou correlação negativa em relação ao peso do intestino. A atividade da lipase mostrou um efeito significativamente negativo no peso do intestino. A atividade da amilase no eixo y (PC2) contribuiu com 13% na variação, mas não se correlacionou significativamente com os dois primeiros componentes principais, demonstrando correlação negativa e não significativa em relação ao peso e comprimento e fator de Fulton, enquanto correlação positiva, mas não significativa com outras características. A protease tem correlação positiva e não significativa com o peso do peixe, RGL, fator de Fulton, lipase e amilase, enquanto correlação negativa não significativa com todas as outras características. estudo digestivas lipases Terapon jarbua. jarbua . jarbua” peixes (RGL (RGM TL, TL , (TL) GW (GW CG. CG (CG) PC2 PC (PC2 13 variação principais (TL (CG (PC 1

Resumo O peixe é considerado o mais adequado para indicação de toxicidade na água. Assim, o objetivo do presente estudo foi determinar as concentrações de alguns metais (Na, K, Ca, Mg, Fe, Cd, Pb e Zn) em relação ao tamanho corporal e fator de condição em Scomberoides commersonnianus. Foi coletado um total de 73 amostras de peixes marinhos, S. commersonnianus, com tamanhos que variaram de 93,4 a 1.180 g de peso corporal e comprimento total de 20,5 a 56,9 cm, aleatoriamente do Mar Arábico de Karachi, Paquistão, para exame de composição elementar. A concentração de Ca foi máxima, enquanto a de Cd foi mínima em S. commersonnianus. As concentrações de Zn mostraram-se altamente significativas negativas (P < 0,001), enquanto Na e Ca apresentaram forte correlação positiva com o tamanho dos peixes. As correlações de Pb, K e Mg foram menos significativas (P < 0,05) com o peso úmido e o comprimento total de S. commersonnianus. Já o Fe e o Cd permaneceram pouco correlacionados (P > 0,05) com o tamanho dos peixes. O fator de condição apresentou correlação altamente significativa (P < 0,001) com todos os metais estudados, exceto Cd e Pb, que foram encontrados correlacionados insignificantemente (P > 0,05) com o fator de condição de S. commersonnianus.

Abstract Fish is thought to be the most appropriate for indication of toxicity in water. So, purpose of present study was to determine the concentrations of few metals (Na, K, Ca, Mg, Fe, Cd, Pb and Zn) in relation to the body size and condition factor in Scomberoides commersonnianus. A total of 73 samples of marine fish, S. commersonnianus with various sizes that ranged from 93.4-1180 g of body weight and total length 20.5-56.9cm were randomly collected from the Arabian Sea of Karachi Pakistan, for examination of elemental composition. The concentration of Calcium found maximum while Cadmium found minimum in S. commersonnianus. Concentrations of Zn showed highly significant (P<0.001) negative, while Na and Ca exhibited strong positive correlation with the fish size. Correlations of Pb, K and Mg were found least significant (P<0.05) with the wet weight and total length of S. commersonnianus. Whereas, Fe and Cd were remained insignificantly correlated (P>0.05) with the fish size. Condition factor showed highly significant correlation (P<0.001) with all studied metals except cadmium and lead which were found insignificantly correlated (P>0.05) with condition factor of S. commersonnianus.

Resumo O objetivo básico deste estudo foi determinar a diversidade ictiofaunística do rio Panjkora nos distritos de Lower e Upper de Dir, na província de Khyber Pakhtunkhwa, no Paquistão. Amostras de peixes foram coletadas com redes de arrasto de março a setembro de 2020. Foram coletados 724 espécimes, classificados em 5 famílias, 14 gêneros e 18 espécies. Os resultados gerais revelaram que a maioria da ictiofauna do rio Panjkora contém 8 espécies da família Cyprinidae (56,49%), seguidas por 4 espécies de Nemacheilidae (24,44%), 2 espécies de Channidae (10,63%) e Sisoridae (7,04%) e 1 espécie de Mastacembelidae (1,38%). Entre todas as espécies de peixes, Schizothorax plagiostomus (16,57%) foi altamente predominante, seguida por Carassius auratus (11,87%) e Racoma labiata (9,66%), e elas foram relatadas como altamente abundantes, especialmente nos meses de abril, maio e junho. As espécies menos abundantes foram Glyptothorax punjabensis, Glyptothorax sufii e Mastacembelus armatus, que constituíram 2,48%, 2,20% e 1,38%, respectivamente, do total de peixes amostrados. O índice de diversidade de Simpson (1-D = 0,919), o índice recíproco de Simpson (1/D = 12,3876) e o índice de Shannon (H = 2,68) indicaram que o rio Panjkora contém um grupo bastante rico e diversificado de espécies de peixes. Os microplásticos mais altos foram observados no local 7 em comparação com outra área de estudo. Medidas de conservação devem ser tomadas como prioridade máxima para proteger e conservar o ambiente marinho e o patrimônio natural de novas perdas e extinção e para parar ou minimizar as perdas ocorridas por práticas de pesca irresponsáveis.

Abstract The basic aim of this study was aimed to determine the ichthyofaunal diversity of River Panjkora in both upper and lower Dir districts in Khyber Pakhtunkhwa province of Pakistan.Fish samples were collected by using fishnets from March to September 2020. A total of 724 specimens were collected and classified into 5 families, 14 genera, and 18 species. The overall results revealed that most fish fauna of river Panjkora contains 8 species of family Cyprinidae (56.49%) followed by 4 species of Nemacheilidae (24.44%), 2 species of Channidae (10.63%), and Sisoridae (7.04%), and 1 species of Mastacembelidae (1.38%), respectively. Among all kinds of fish species, Schizothorax plagiostomus (16.57%) was highly dominated and followed by Carassius auratus (11.87%) and Racoma labiata (9.66%) and were reported as highly abundant, especially during April, May, and June. The least abundant species were Glyptothorax punjabensis, Glyptothorax sufii, and Mastacembelus armatus, that constituting 2.48%, 2.20%, and 1.38% of the total fish samples. The Overall Simpson’s diversity (1-D= 0.919) and Simpson’s Reciprocal index values (1/D= 12.3876), and Shannon’s index (H= 2.68) were indicating that river Panjkora contains a quite rich and diverse group of fish species. The highest microplastics observed in site 7 compared to other study area. Conservation steps should be taken as a top priority to protect and conserve the marine environment and natural heritage from further loss, extinction and stop or minimize losses incurred through irresponsible fishery practices

Resumo Ophiactis savignyi pode ser descoberta em todo o mundo em ambientes marinhos tropicais. A população pode ter contribuído para a propagação de O. savignyi, particularmente as populações ocidentais e orientais do istmo do Panamá. A estrela-quebradiça O. savignyi, muitas vezes conhecida como estrela-quebradiça de Savignyi, coexiste com a esponja Geodia corticostylifera. O foco desta pesquisa foi avaliar a relevância funcional dos metabólitos secundários de G. corticostylifera como anti-incrustante contra mexilhões, proteção contra peixes generalistas e sinais químicos para estrelas-quebradiças afiliadas. Em estudos de laboratório com fluxo contínuo e estático de água do mar, O. savignyi, que anteriormente havia se ligado a esponjas, recebeu mimetizadores tratados e controle ao mesmo tempo. O extrato de esponja também foi testado por sua capacidade de proteger os peixes contra predadores e incrustações. Testes de dissuasão usando produtos químicos indicaram que o nível normal de extrato de esponja também pode suprimir a predação de peixes generalistas no campo, bem como a fixação normal do mexilhão Perna perna em ambientes clínicos. De acordo com os achados, o extrato bruto de G. corticostylifera tem diversas funções em ambientes aquáticos, aparentemente responsáveis pela relação mais próxima dessa esponja com O. savignyi, protegendo o ofiuroide e inibindo os epibiontes.

Abstract Ophiactis savignyi could be discovered all over the world in tropical marine environments. People could have aided in the spread of O. savignyi, particularly in the western and eastern populations of Panama's Isthmus. The brittle star Ophiactis savignyi, often known as savigny's brittle star, coexists alongside the sponge Geodia corticostylifera. The focus of this research has been to assess the functional relevance of G. corticostylifera secondary metabolites as antifoulant against mussels, protection against generalist fish, and chemical cues to affiliated brittle stars. Both in flow-through and static seawater laboratory studies, O. savignyi which has previously been connected with sponges, was given both treated and control mimics at the same time. The sponge extract was also tested for its ability to protect fish against predators and fouling. Deterrence test using chemicals indicated that the normal level of the sponge extract may also suppress generalist fish predation in the field as well as the mussel Perna perna’s normal attachment in clinical contexts. According to the findings, G. corticostylifera crude extract has many roles in the aquatic environments, apparently being accountable for this sponge's tighter relationship with O. savignyi, which protects the ophiuroid and inhibits epibionts on itself.