Abstract Introduction: A recent revision of the generic classification of the Trochilidae based on DNA sequences revealed many inconsistencies with the current generic classification, largely based on plumage characters subject to homoplasy, especially in the Trochilini, the largest tribe. A thorough generic reorganization brought the classification into accord with the phylogeny, but due to lack of genetic data, two species remained unclassified. One of these was the Mangrove Hummingbird, “Amazilia” boucardi, endemic to Costa Rica and included in the IUCN red list of threatened species. Objective: To obtain molecular evidence to clarify the generic relationships of “A.” boucardi. Methods: We isolated DNA from tissues of this species and amplified 4 nuclear and 4 mitochondrial fragments and compared these with homologous fragments from 56 species in the Trochilini, constructing phylogenetic trees with maximum likelihood and Bayesian methods. Results: Our phylogenetic analyses confirmed the placement of boucardi in the Trochilini and definitely excluded it from Amazilia but placed it with high confidence in the genus Chrysuronia Bonaparte, 1850, within which its closest relative is C. coeruleogularis, which also inhabits mangroves. Conclusions: Our genetic data based on nuclear and mitochondrial regions clearly indicate the relationship of A. boucardi and L. coeruleogularis. Moreover, it is also supported by their habitat distribution in the mangroves of the Pacific coast of Costa Rica and Western Panama. Therefore, we suggested to exclude A. boucardi as “incertae sedis”.

Resumen Introducción: Una revisión reciente de la clasificación de la familia Trochilidae con base en secuencias de ADN demostró muchas incongruencias con la clasificación genérica previa, que había sido hecho con base en caracteres del plumaje muy sujetos a homoplasia, especialmente en la tribu más grande, Trochillini. Una reorganización de los géneros logró llevar su clasificación genérica a la concordancia con la filogenia, pero debido a la ausencia de datos genéticos, dos especies permanecieron sin clasificar. Una de estas fue el colibrí de manglar Amazilia boucardi, una especie endémica de Costa Rica, considerada como amenazada en la lista roja de la UICN. Objetivo: Obtener evidencia molecular para esclarecer las relaciones genéricas de A. boucardi. Métodos: Se aisló ADN de tejidos de esta especie y se amplificaron 4 fragmentos de ADN del núcleo y 5 de la mitocondria, y se compararon con fragmentos homólogos de 56 especies en la tribu Trochillini, generando árboles filogenéticos con métodos de máxima verosimilitud y bayesiano. Resultados: Los análisis filogénticos obtenidos confirmaron la ubicación de boucardi en Trochilini y definitivamente la excluyó del género Amazilia, pero la ubicó con un alto grado de confianza en el género Chrysuronia Bonaparte, 1850, dentro los cuales su pariente más cercano es C. coeruleogularis, que también habita manglares. Conclusiones: Nuestros datos genéticos basados en regiones nucleares y mitocondriales indican claramente la relación entre A. boucardi and L. coeruleogularis. Es más, lo anterior se sustenta por su distribución en los manglares de la costa Pacífica de Costa Rica y oeste de Panamá. Por lo tanto, sugerimos excluir a A. boucardi como “incertae sedis”.

Resumen En este trabajo presentamos el análisis de la secuencia mitocondrial completa de una muestra biológica perteneciente a Blas Jaime, reconocido como chaná, hablante de la lengua chaná y originario de la región centro-sur de la provincia de Entre Ríos. La información se presenta en el contexto genealógico y geográfico de Jaime, y en el marco de los antecedentes genéticos disponibles para la región. El objetivo de este estudio es aportar al conocimiento, desde una perspectiva multidisciplinaria, de la lengua chaná a partir de la información lograda, desde la reconstrucción genealógica y del secuenciamiento del genoma mitocondrial de Blas Jaime. Los resultados sugieren la existencia de un vínculo filogenético y diferenciación temprana con indígenas kayapó de la región central de Brasil y con pobladores del este de Paraguay.

Abstract In this work, we present the analysis of the complete mitochondrial sequence of a biological sample belonging to Blas Jaime, recognized as Chaná, speaker of the Chaná language, and native of the southern-central region of the province of Entre Ríos. The information is presented within the genealogical and geographical context of Jaime and in the framework of the genetic background available for the region. The objective of this study is to contribute to the understanding, from a multidisciplinary perspective, of the contexts of the Chaná language based on the information obtained from genealogical reconstruction and the sequencing of the Blas Jaime’s mitochondrial genome. The results suggest the existence of a phylogenetic link and early differentiation with Kayapó indigenous peoples from the central region of Brazil and with inhabitants of eastern Paraguay.

Resumo Neste trabalho, apresentamos a análise da sequência mitocondrial completa de uma amostra biológica pertencente a Blas Jaime, reconhecido como Chaná, falante da língua Chaná e originário da região centro-sul da província de Entre Ríos. A informação é apresentada no contexto genealógico e geográfico de Jaime e no âmbito dos antecedentes genéticos disponíveis para a região. O objetivo deste estudo é contribuir para o conhecimento, a partir de uma perspectiva multidisciplinar, dos contextos da língua Chaná com base das informações obtidas na reconstrução genealógica e no sequenciamento do genoma mitocondrial de Blas Jaime. Os resultados sugerem a existência de um vínculo filogenético e diferenciação precoce com os indígenas Kayapó da região central do Brasil e com habitantes do leste do Paraguai.

Abstract The essay critically presents two territorial scale projects prepared at different times but grouped under a common approach. The reasoning starts from the notion of restoration proposed by Franco Purini that captured the attention of the scientific community at the beginning of the nineties, according to which, the historically shaped landscape needs, after the damage caused by modernity, a restoration operation. renovatio, capable of pushing beyond conservation. A position that opens fertile and generative spaces for reflection, even in relation to the operational dimension of the project. The analytical, inclusive, transversal view of the disciplines that we have adopted in the preparation of the projects is informed by a single synthetic objective that unites everything. This refers to the possibility, based on the selective recapitulation of the phylogeny, of prefiguring through guidelines, corrections and actions (material and immaterial), different scenarios with respect to the present and the evolutionary projection of a given territory. By redefining materials, weights, measures and relationships between the parts, valuing hidden or frustrated levels of the palimpsest, it is possible to reconstruct a territorial framework capable of proposing future orders, compatible with the rules of the longue durée that have acted in the formation of territories, as a result contingent of the stratification and sedimentation of signs.

Resumen El ensayo presenta críticamente dos proyectos de escala territorial confeccionados en tiempos distintos pero agrupados bajo un enfoque común. El razonamiento parte de la noción de restauración propuesta por Franco Purini que capta la atención de la comunidad científica al inicio de los años noventa, según la cual, el paisaje históricamente conformado necesita, luego de los daños provocados por la modernidad, de una operación de renovatio, capaz de empujar más allá de la conservación. Una posición que abre espacios de reflexión fértiles y generativos, incluso en relación a la dimensión operativa del proyecto. La mirada analítica, inclusiva, transversal respecto de las disciplinas, que hemos adoptado en la confección de los proyectos, está informada por un único objetivo sintético que todo lo une. Esto hace referencia a la posibilidad, a partir de la recapitulación selectiva de la filogenia, de prefigurar mediante directrices, correcciones y acciones (materiales e inmateriales), escenarios distintos respecto del presente y de la proyección evolutiva de un territorio dado. Redefiniendo materiales, pesos, medidas y relaciones entre las partes, valorizando niveles ocultos o frustrados del palimpsesto, es posible reconstruir una armadura territorial capaz de proponer órdenes futuros, compatibles con las reglas de la longue durée que han actuado en la conformación de territorios, resultado contingente de la estratificación y de la sedimentación de los signos.

Abstract Evolution has originated high levels of biodiversity that provide essential actual benefits to humans and future called option values. These resources are extracted and used to meet basic needs, such as traditional medicine, which is the result of human experience and its contact with nature over time. Traditional knowledge used as a guide for bioprospecting and ethnomedicinal research is the first step to protecting it and making it visible. The need to apply phylogenetic approaches and their importance for the development of ethnobotany in Mexico is discussed, as well as their implications for the discovery, use and conservation of medicinal resources for human well-being. This approaches, elucidating the evolutionary history of species, can improve bioprospecting practices since they point out related species which could produce useful chemical compounds, which is relevant to biotechnology and emphasizes the importance of preserving biocultural heritage.

Resumen La evolución ha producido una gran biodiversidad que proporciona al ser humano bienes esenciales actuales y opciones de valor de facturas. Estos recursos son extraídos y empleados para satisfacer necesidades básicas, como la medicina tradicional, resultado de la experiencia y el contacto humano con la naturaleza a través del tiempo. Los saberes tradicionales han sido aprovechados como guía para la bioprospección y los estudios etnobotánicos son el primer paso para visibilizarlos y protegerlos. Se plantea la necesidad de aplicar aproximaciones filogenéticas y su importancia para el desarrollo de la etnobotánica en México, así como su impacto en el descubrimiento, aprovechamiento y conservación de recursos medicinales para el bienestar humano. Estas aproximaciones, que revelan la historia evolutiva de las especies, pueden fortalecer la bioprospección, ya que señalan especies emparentadas que pudieran llegar a producir sustancias químicas útiles, lo que resulta relevante para la biotecnología y resalta la importancia de la conservación del patrimonio biocultural.

Abstract Mackerel fish (Scomberomorus spp.) represents a significant marine fisheries commodity in Indonesia, characterized by its high commercial value and nutritional content. To understand the intraspecific interactions and genetic variability of Scomberomorus spp., a more extensive research of Scomberomorus spp. populations, including both cultivated and wild specimens, is required. This study aimed to explore the genetic diversity of mackerel fish in Indonesian waters, focusing on the mitochondrial DNA (mtDNA) cytochrome oxidase subunit II (COII) gene, which encodes the second subunit of cytochrome c oxidase (complex IV), is essential for aerobic respiration and energy transformation. Muscle tissue samples from 18 individual mackerel fish collected from various regions in Indonesia, including Palembang, Cilacap, Rembang, Banjarmasin, Ambon, and Fak-Fak Regencies, were utilized. The genomic DNA was isolated and amplified using specific primers: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') and CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Subsequently, the obtained amplicons were subjected to sequencing. The sequence data were then analyzed using the MEGA11 and DnaSP 6 software. Our findings revealed 120 variable sites within the 691 base pairs of mtDNA COII sequences, resulting in a nucleotide diversity (Pi) of 0.07169. Furthermore, we identified eight haplotypes, demonstrating a haplotype diversity (Hd) of 0.8889. Remarkably, all mackerel samples from Palembang and Cilacap clustered into discrete haplotypes, specifically haplotype 1 and haplotype 2, respectively. Our phylogenetic analysis delineated three distinct clades. Clade I, closely related to Scomberomorus cavalla, encompassed all individuals from Ambon, Palembang, Rembang, and one from Banjarmasin. Clade II, associated with Scomberomorus niphonius, included individuals from Cilacap and two from Banjarmasin. Clade III, linked to Scomberomorus semifasciatus, exclusively consisted of individuals from Fak-Fak (Papua). In conclusion, Indonesian waters harbor diverse genetic variations within Scomberomorus spp., and population relationships based on the mtDNA COII gene exhibit notable complexities. Future research endeavors should focus on further elucidating the diversity and relationships among Scomberomorus spp. in diverse Indonesian populations. spp Indonesia content populations specimens required (mtDNA (COII complex IV, IV , IV) transformation Rembang Banjarmasin Ambon FakFak Fak Regencies utilized primers COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Subsequently sequencing MEGA MEGA1 software 12 69 sequences Pi (Pi 007169 0 07169 0.07169 Furthermore haplotypes Hd (Hd 08889 8889 0.8889 Remarkably 2 respectively clades I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusion complexities 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0.0716 0888 888 0.888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0.071 088 88 0.88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0.07 08 8 0.8 (5'-ATGTCACTAAGGGTGGTTGG 00 0.0 0.

Resumo O peixe cavala (Scomberomorus spp.) representa uma importante commodity da pesca marinha na Indonésia, caracterizada pelo seu alto valor comercial e conteúdo nutricional. Para entender as interações intraespecíficas e a variabilidade genética do Scomberomorus spp., é necessária uma pesquisa mais ampla das populações de Scomberomorus spp. Este estudo teve como objetivo explorar a diversidade genética do peixe cavala nas águas da Indonésia, com foco no gene mitocondrial do DNA (mtDNA) da subunidade II da citocromo oxidase (COII) que codifica a segunda subunidade da citocromo c oxidase (complexo IV), essencial para a respiração aeróbica e a transformação de energia. Foram utilizadas amostras de tecido muscular de 18 peixes cavala individuais, coletados de diversas regiões da Indonésia, incluindo Palembang, Cilacap, Rembang, Banjarmasin, Ambon e Regiões de Fak-Fak. O DNA genômico foi isolado e amplificado utilizando iniciadores específicos: CO2TF (5'-ACCGCTCTGTCACTTTCTTC-3') e CO2TR (5'-ATGTCACTAAGGGTGGTTGG-3'). Posteriormente, os amplicons obtidos foram submetidos a sequenciamento. Os dados de sequência foram então analisados usando o software MEGA 11 e DnaSP 6. Nossos resultados revelaram um total de 120 sítios variáveis dentro dos 691 pares de bases das sequências de mtDNA COII, resultando em uma diversidade de nucleotídeos (Pi) de 0,07169. Além disso, identificamos oito haplótipos distintos, demonstrando uma diversidade haplotípica (Hd) de 0,8889. Notavelmente, todas as amostras de peixe cavala de Palembang e Cilacap se agruparam em haplótipos distintos, especificamente haplótipo 1 e haplótipo 2, respectivamente. Nossa análise filogenética delineou três clados distintos. O Clado I, intimamente relacionado ao Scomberomorus cavalla, englobou todos os indivíduos de Ambon, Palembang, Rembang e um de Banjarmasin. O Clado II, associado ao Scomberomorus niphonius, incluiu indivíduos de Cilacap e dois de Banjarmasin. O Clado III, ligado ao Scomberomorus semifasciatus, consistiu exclusivamente de indivíduos de Fak-Fak (Papua). Em conclusão, as águas indonésias abrigam diversas variações genéticas dentro de Scomberomorus spp., e as relações populacionais com base no gene mtDNA COII apresentam complexidades notáveis. Futuros empreendimentos de pesquisa devem se concentrar em elucidar ainda mais a diversidade e as relações entre as populações de Scomberomorus spp. em diversas regiões da Indonésia. spp Indonésia nutricional (mtDNA (COII complexo IV, IV , IV) energia individuais Banjarmasin FakFak. FakFak Fak Fak. específicos COTF CO TF 5ACCGCTCTGTCACTTTCTTC3 ACCGCTCTGTCACTTTCTTC 5 3 (5'-ACCGCTCTGTCACTTTCTTC-3' COTR TR 5ATGTCACTAAGGGTGGTTGG3. 5ATGTCACTAAGGGTGGTTGG3 ATGTCACTAAGGGTGGTTGG . (5'-ATGTCACTAAGGGTGGTTGG-3') Posteriormente sequenciamento 6 12 69 Pi (Pi 007169 0 07169 0,07169 disso distintos Hd (Hd 08889 8889 0,8889 Notavelmente 2 respectivamente I cavalla niphonius III semifasciatus Papua. Papua (Papua) conclusão notáveis 5ACCGCTCTGTCACTTTCTTC (5'-ACCGCTCTGTCACTTTCTTC-3 5ATGTCACTAAGGGTGGTTGG (5'-ATGTCACTAAGGGTGGTTGG-3' 00716 0716 0,0716 0888 888 0,888 (Papua (5'-ACCGCTCTGTCACTTTCTTC- (5'-ATGTCACTAAGGGTGGTTGG-3 0071 071 0,071 088 88 0,88 (5'-ACCGCTCTGTCACTTTCTTC (5'-ATGTCACTAAGGGTGGTTGG- 007 07 0,07 08 8 0,8 (5'-ATGTCACTAAGGGTGGTTGG 00 0,0 0,

Resumo Este trabalho apresenta o isolamento de fungos endofíticos de folhas de Campomanesia adamantium(Cambess.) O. Berg (Myrtaceae), espécie nativa encontrada no Brasil, com distribuição abundante no Cerrado brasileiro, popularmente conhecida como “guabiroba-do-campo. Têm sido utilizadas popularmente por suas atividades anti-reumáticas anti-inflamatórias, antidiarreicas, redutoras de colesterol no sangue, antisséptica urinária e depurativas. Fungos endofíticos são microrganismos que vivem no interior de plantas superiores, ao menos por um período de seu ciclo de vida, ocupando os espaços intercelulares dos tecidos vegetais, como folhas e caules. Esses fungos, além de serem inofensivos à planta hospedeira, produzem benefícios a partir de metabólitos secundários que promovem proteção, regulam o crescimento, combatem bactérias, vírus e fungos e promovem resistência a estresse abiótico, além de efeitos inseticidas. Os fungos endófitos associados às folhas de C. adamantiumforam isolados utilizando-se a técnica de isolamento em meio de cultura. Logo após o crescimento, os fungos foram divididos em grupos baseados em morfotipos. O DNA genômico fúngico foi extraído A reação em cadeia da polimerase (PCR) foi conduzida para amplificação da região ITS-1-5.8S-ITS2 de rRNA e as sequências de nucleotídeos obtidas foram comparados com aqueles disponíveis na base de dados GenBank para a identificação molecular dos isolados. A construção da filogenia da árvore foi realizada utilizando o software MEGA 11. Os resultados apresentaram representantes do filo Ascomycota e em nível de gênero foi possível identificar 18 fungos dos gêneros Colletotrichum, Diaporthe, Epicoccum e Neofusicoccum. adamantiumCambess. adamantiumCambess adamantium Cambess. Cambess adamantium(Cambess. Myrtaceae, Myrtaceae , (Myrtaceae) Brasil brasileiro guabirobadocampo. guabirobadocampo guabiroba campo. campo “guabiroba-do-campo antireumáticas anti reumáticas antiinflamatórias, antiinflamatórias inflamatórias, inflamatórias anti-inflamatórias antidiarreicas sangue depurativas superiores vida vegetais caules hospedeira proteção crescimento bactérias abiótico inseticidas C utilizandose se cultura morfotipos PCR (PCR ITS15.8SITS2 ITS158SITS2 ITSSITS ITS 1 5.8S ITS2 5 8S S ITS-1-5.8S-ITS 11 Colletotrichum Diaporthe Neofusicoccum adamantium(Cambess (Myrtaceae ITS15 8SITS2 SITS ITS15.8SITS ITS158SITS 58S ITS1 8SITS

Abstract This work presents the isolation of endophytic fungi from the leaves of Campomanesia adamantium (Cambess.) O. Berg (Myrtaceae), a native species found in Brazil and popularly known as “guabiroba-do-campo”, with abundant distribution in the Brazilian Cerrado. It has been popularly used for its anti-rheumatic, anti-inflammatory, antidiarrheal, blood cholesterol-reducing, urinary antiseptic, and depurative properties. Theese fungi are microorganisms that live inside higher plants, at least for a period of their life cycle, occupying the intercellular spaces of plant tissues such as leaves and stems. These fungi are harmless to the host plant, and their secondary metabolites promote protection, regulate growth, combat bacteria, viruses, and fungi, and promote resistance to abiotic stress, as well as insecticidal effects. Endophytic fungi associated with the leaves of C. adamantium were isolated using the culture medium isolation technique. After growth, the fungi were divided into groups based on morphotypes. Fungal genomic DNA was extracted, and a polymerase chain reaction (PCR) was conducted to amplify the ITS1-5.8S-ITS2 regions of rRNA, and the nucleotide sequences obtained were compared with those available in the GenBank database for molecular identification of the isolates. The phylogenetic tree was constructed using MEGA 11 software. The results showed representatives of the Ascomycota phylum, and it was possible to identify at the genus level 18 fungi of the genera Colletotrichum, Diaporthe, Epicoccum, and Neofusicoccum. Cambess. Cambess (Cambess. O Myrtaceae, Myrtaceae , (Myrtaceae) guabirobadocampo, guabirobadocampo guabiroba do campo “guabiroba-do-campo” Cerrado antirheumatic, antirheumatic anti rheumatic, rheumatic anti-rheumatic antiinflammatory, antiinflammatory inflammatory, inflammatory anti-inflammatory antidiarrheal cholesterolreducing, cholesterolreducing cholesterol reducing, reducing cholesterol-reducing antiseptic properties plants cycle stems protection growth bacteria viruses stress effects C technique morphotypes extracted PCR (PCR ITS15.8SITS2 ITS158SITS2 ITSSITS ITS1 5.8S ITS2 5 8S ITS S ITS1-5.8S-ITS rRNA isolates 1 software phylum Colletotrichum Diaporthe Epicoccum Neofusicoccum (Cambess (Myrtaceae “guabiroba-do-campo ITS15 8SITS2 SITS ITS15.8SITS ITS158SITS 58S 8SITS

Resumo Surtos frequentes do vírus da gripe aviária H9N2 no Paquistão revelaram que esse subtipo se tornou endêmico na avicultura e, além das perdas econômicas, representa uma ameaça à saúde pública. O presente estudo descreve a caracterização molecular e as alterações patológicas em frangos de corte naturalmente infectados com a atual cepa H9N2 e sua dinâmica filogenômica. Neste estudo, amostras de tecidos (traqueia, pulmões, rim e intestino) de 100 lotes comerciais de frangos foram coletadas de julho de 2018 a agosto de 2019. As amostras foram submetidas à detecção molecular, filogenia e posterior exame patológico. O comprimento completo do gene HA foi amplificado com sucesso em cinco amostras. O sequenciamento de nucleotídeos revelou amostras positivas colocadas em um clado pertencente à sublinhagem B2 do genótipo G1 e categorizado como LPAIV com base na sequência de aminoácidos do gene da hemaglutinina (HA) no local de clivagem (PAKSSR/G). A análise genética do gene da HA revelou: nt = 80,5%-99,5%; aa = 83,8%-98,9% de homologia com cepas de H9N2 relatadas anteriormente no Paquistão e em países vizinhos (A/Quail/Hong Kong/G1/97). As lesões macroscópicas incluíram aerossaculite leve, hemorragias leves, congestão difusa e exsudato purulento na mucosa traqueal, cilindro fibrinonecrótico no lúmen da traqueia e congestão pulmonar leve. As alterações histopatológicas incluíram descamação de células epiteliais, infiltração de células inflamatórias na traqueia, infiltração de células mononucleares (MNCs), congestão pulmonar e exsudato no lúmen dos parabrônquios, congestão peritubular nos rins com degeneração das células epiteliais tubulares, alterações degenerativas nas células epiteliais das vilosidades intestinais e hiperplasia de células caliciformes. A análise imunoistoquímica confirmou a presença do antígeno AIVH9N2 na traqueia, nos pulmões, no rim e no intestino. A microscopia eletrônica revelou alterações ultraestruturais na traqueia, incluindo cílios degenerados, inchaço mitocondrial e retículo endoplasmático aumentado. Com base em todas as análises, o presente estudo revelou a distribuição do vírus H9N2 do genótipo G1 em Punjab, Paquistão, com patogenicidade de leve a moderada.

Abstract Frequent outbreaks of avian influenza H9N2 virus in Pakistan revealed that this subtype has become endemic in the poultry industry and, besides economic losses, poses a threat to public health. The present study describes the molecular characterization and pathological alterations in naturally infected broiler chickens with the current H9N2 field strain and their phylogenomic dynamics. In this study, tissue samples (trachea, lung, kidney and intestine) from 100 commercial chicken flocks were collected from July 2018 to August 2019. Samples were subjected to molecular detection, phylogeny and subsequent pathological examination. The complete length of the HA gene was successfully amplified in five samples. Nucleotide sequencing revealed positive samples placed in a clade belonging to the B2 sub-lineage of the G1 genotype and categorized as LPAIV based on the amino acid sequence of the HA gene at the cleavage site (PAKSSR/G). Genetic analysis of the haemagglutinin (HA) gene revealed nt: 80.5%-99.5%; aa: 83.8%-98.9% homology to H9N2 strains reported previously from Pakistan, neighbouring countries, and (A/Quail/Hong Kong/G1/97). Gross lesions include a slight airsacculitis, mild hemorrhages, diffuse congestion and purulent exudate in tracheal mucosa, fibrinonecrotic cast in the trachea lumen and mild pulmonary congestion. Histopathological alterations include sloughing of epithelial cells and infiltration of inflammatory cells in the trachea, mononuclear cells (MNCs) infiltration, pulmonary congestion and exudate in the lumen of parabronchi, peritubular congestion in the kidneys with degeneration of tubular epithelial cells and degenerative changes in the intestinal villi epithelial cells and goblet cell hyperplasia. Immunohistochemistry analysis confirmed the presence of AIVH9N2 antigen in the trachea, lungs, kidney and intestine. Electron microscopy revealed ultrastructural changes in the trachea, including degenerated cilia, mitochondrial swelling and enlarged endoplasmic reticulum. Based on all essential analysis, the present study revealed the distribution of the H9N2 virus of G1 genotype in Punjab, Pakistan, with mild to moderate pathogenicity.

ABSTRACT: Canine parvovirus 2 (CPV-2) is an important causative agent of segmental enteritis in young dogs and has globally distributed variants and subtypes. Viral mutations can alter the pathogenesis and clinical signs, making identifying the samples circulating in a given region relevant. This study described the epidemiological and clinical findings and the molecular characterization of CPV-2 samples circulating in the canine population of Uruguaiana, Rio Grande doSul (RS), Brazil. We analyzed 27 cases with a complete clinical history and at least one confirmatory etiologic diagnosis. In addition to clinical and epidemiological data, whole blood samples or tissues were tested by PCR for viral DNA detection. Amplified products were sequenced and analyzed, and phylogeny was generated with reference sequences. The disease was diagnosed especially in the summer months, and the most common clinical findings were diarrhea, anorexia, listlessness, and vomiting. Infection was predominant in young (< 6 months) unvaccinated or partially immunized dogs, with mortality exceeding 93%. It was possible to identify 15 CPV-2 samples, four of which were CPV-2a and 11 were new CPV-2a. It can be concluded that canine parvovirus is a disease with high mortality rates, with young unvaccinated dogs being more susceptible, with a predominance of the new CPV-2a variant in the western region of Rio Grande do Sul. ABSTRACT CPV2 CPV (CPV-2 subtypes signs relevant CPV- Uruguaiana RS, RS , (RS) Brazil diagnosis data detection sequences months diarrhea anorexia listlessness vomiting < ( 93 93% 1 CPV2a CPVa 2a CPV2a. 2a. rates susceptible Sul (CPV- (RS 9 (CPV

RESUMO: O parvovírus canino 2 (CPV-2) é um importante agente etiológico de enterite segmentar em cães jovens e apresenta variantes e subtipos distribuídos mundialmente. As mutações virais podem alterar a patogenia e os sinais clínicos, o que torna relevante identificar as amostras que circulam em determinada região. O objetivo do trabalho foi descrever os achados epidemiológicos, clínicos e a caracterização molecular das amostras de CPV-2 circulantes na população canina do município de Uruguaiana, Rio Grande do Sul (RS), Brasil. Foram analisados 27 casos clínicos que possuíam histórico clínico completo e pelo menos um diagnóstico etiológico confirmatório. Além dos dados clínicos e epidemiológicos, amostras de sangue total, suabes retais ou tecidos foram testados por PCR para detecção do DNA viral. Os produtos amplificados foram sequenciados, analisados e a filogenia gerada com sequências de referência. A doença foi diagnosticada especialmente nos meses de verão e os achados clínicos mais comuns foram diarreia, anorexia, apatia e vômito. A infecção foi predominante em cães jovens (< 6 meses) não vacinados ou parcialmente imunizados, com mortalidade superior a 93%. Foi possível identificar quinze amostras de CPV-2, sendo quatro CPV-2a e onze new CPV-2a. Pode-se concluir que a parvovirose canina é uma enfermidade com altos índices de mortalidade, sendo os cães jovens não vacinados mais susceptíveis, havendo predominância da variante new CPV-2a na região oeste do RS. RESUMO CPV2 CPV (CPV-2 mundialmente epidemiológicos CPV- Uruguaiana RS, RS , (RS) Brasil confirmatório total viral sequenciados referência diarreia anorexia vômito < ( imunizados 93 93% CPV2, 2, CPV2a CPVa 2a CPV2a. 2a. Podese Pode se susceptíveis (CPV- (RS 9 (CPV

Abstract A new species of Inpaichthys is described from a tributary of the rio Canamã, rio Aripuanã basin, Mato Grosso State, Brazil. The new species can be diagnosed from its congeners by the color pattern in life and by morphometric and meristic features. A comprehensive phylogenetic analysis of the Characidae, conducted to assess the generic placement of the new species, revealed that Hasemania nambiquara is also a member of Inpaichthys and thus transferred to this genus. A monophyletic group composed of the three known species of Inpaichthys is hypothesized to be related to Nematobrycon and a clade composed of Carlana, Pseudochalceus, and Rhoadsia, among the taxa herein analyzed. A diagnosis for Inpaichthys and morphometric and meristic data of I. kerri are also presented. Canamã basin State Brazil features Characidae genus Carlana Pseudochalceus Rhoadsia analyzed I presented

Resumo Uma espécie nova de Inpaichthys é descrita de um tributário do rio Canamã, bacia do rio Aripuanã, estado de Mato Grosso, Brasil. A espécie nova pode ser diagnosticada de suas congêneres por seu padrão de colorido em vida e por caracteres morfométricos e merísticos. Uma ampla análise filogenética de Characidae, conduzida para avaliar o posicionamento genérico da nova espécie, demonstrou que Hasemania nambiquara também é um membro do gênero Inpaichthys e esta espécie é aqui transferida a esse gênero. Um grupo monofilético composto pelas três espécies de Inpaichthys é hipotetizado como sendo relacionado a Nematobrycon e o clado composto por Carlana, Pseudochalceus e Rhoadsia, entre os táxons aqui examinados. Uma diagnose para Inpaichthys e os dados morfométricos e merísticos de I. kerri também são apresentados. Canamã Aripuanã Grosso Brasil Characidae Carlana Rhoadsia examinados I apresentados

ABSTRACT Wild birds have great prominence in the transmission of diseases to humans, mainly due to their ease of access to human populations, raising concerns about the potential impact of that proximity on public health. The present study reports ARV and PBV occurrence in wild birds from an environmental protection area in the Amazon biome, in Pará state, Brazil. We obtained 155 fecal specimens from 47 species of wild birds for RNA extraction, ARV and PBV detection utilizing molecular methods, nucleotide sequencing, and phylogenetic analysis. ARV prevalence was 0.6% (1/155), being positive in an individual of Myrmotherula longipennis, and PBV prevalence was 1.29% (2/155), affecting two individuals of Guira guira. The PBV strains were assigned to genogroup I based on phylogenetic analysis, and they shared a strong phylogenetic link with strains isolated from different geographic locations. The ARV strain was more closely related to strains that had previously circulated in the same region. The presence of ARV and PBV in this habitat suggests that infection cycles of these agents occur naturally in the wild ecosystem, potentially triggering transmission events between bird species and humans. This is the first study on ARV detection in wild birds in Brazil and the first report on the occurrence of PBV in wild Guira guira. Additional studies are required to determine the epidemiology, origin, evolution, and emergence of new potentially pathogenic viruses in the Amazon. humans populations health biome state 15 4 extraction methods sequencing analysis 06 0 6 0.6 1/155, 1155 1/155 , 1 (1/155) longipennis 129 29 1.29 2/155, 2155 2/155 2 (2/155) guira locations region ecosystem epidemiology origin evolution 0. 115 1/15 (1/155 12 1.2 215 2/15 (2/155 11 1/1 (1/15 1. 21 2/1 (2/15 1/ (1/1 2/ (2/1 (1/ (2/ (1 (2 (

RESUMO As aves silvestres têm grande destaque na transmissão de doenças ao homem, principalmente pela facilidade de acesso à população humana, levantando preocupações sobre o potencial impacto dessa proximidade no contexto da saúde pública. O presente estudo relata a ocorrência de ARV e PBV em aves silvestres de uma área de proteção ambiental no bioma Amazônico. Obtivemos 155 espécimes fecais de 47 espécies de aves silvestres, que foram submetidos a extração de RNA, detecção de ARV e PBV por técnicas moleculares, sequenciamento nucleotídico e análise filogenética. A prevalência de infecção por ARV foi 0,6% (1/155), sendo positivo em um indivíduo de Myrmotherula longipennis, e a prevalência de PBV foi 1,29% (2/155), afetando dois insdivíduos de Guira guira. A análise filogenética agrupou as cepas de PBV no genogrupo I, mostrando intensa relação filogenética com cepas isoladas de outras regiões geográficas. A cepa de ARV esteve mais relacionada filogeneticamente a cepas previamente circulantes na mesma região. Este é o primeiro estudo sobre detecção de ARV em aves silvestres no Brasil e o primeiro relato sobre a ocorrência de PBV em Guira guira. A circulação de ARV e PBV nesse ambiente demonstra que os ciclos desses agentes estão ocorrendo de forma natural no ecossistema silvestre, o que pode desencadear possíveis eventos de transmissão entre as espécies aviárias e humanos. Estudos adicionais são necessários para determinar a epidemiologia, origem, evolução e surgimento de novos vírus potencialmente patogênicos na Amazônia. homem humana pública Amazônico 15 4 RNA moleculares 06 0 6 0,6 1/155, 1155 1/155 , 1 (1/155) longipennis 129 29 1,29 2/155, 2155 2/155 2 (2/155) guira I geográficas região silvestre humanos epidemiologia origem Amazônia 0, 115 1/15 (1/155 12 1,2 215 2/15 (2/155 11 1/1 (1/15 1, 21 2/1 (2/15 1/ (1/1 2/ (2/1 (1/ (2/ (1 (2 (

ABSTRACT Guinea grass (Megathyrsus maximus) is widely used as a forage crop in Brazil, but its production faces disease threats. Recently, new symptoms, such as oblong to irregular brown lesions on leaves, have emerged in M. maximus across the country. Particularly severe symptoms were observed in the BRS Tamani cultivar, and some other genotypes showed lesion coalescence and intense leaf necrosis. This study aimed to identify the cause of these symptoms. A fungus was isolated from the lesions and, using morphological measurements and molecular analysis of the ITS, GPDH and TEF-1α genes, it was identified as Bipolaris yamadae. Pathogenicity tests confirmed its ability to cause disease in M. maximus cv. Tamani. A field survey of 205 M maximus genotypes showed severe symptoms in 8.35 % of the materials. Megathyrsus Brazil threats Recently leaves country cultivar necrosis ITS TEF1α TEFα TEF 1α α genes yamadae cv 20 835 8 35 8.3 materials 2 83 3 8.

RESUMO O capim-colonião (Megathyrsus maximus) é amplamente utilizado como cultura forrageira no Brasil, mas sua produção enfrenta ameaças de doenças. Recentemente, novos sintomas, como lesões marrons oblongas a irregulares nas folhas, surgiram em M maximus em todo o país. Sintomas particularmente severos foram observados na cultivar BRS Tamani, e alguns outros genótipos apresentaram coalescência de lesões e intensa necrose foliar. Objetivou-se identificar a causa desses sintomas. Um fungo foi isolado das lesões e, por meio de medidas morfológicas e análise molecular dos genes ITS, GPDH e TEF-1α, identificado como Bipolaris yamadae. Testes de patogenicidade confirmaram sua capacidade de causar doença em M. maximus cv. Tamani. Um levantamento de campo com 205 genótipos de M maximus revelou sintomas severos em 8,35 % dos materiais. capimcolonião capim colonião Megathyrsus Brasil doenças Recentemente folhas país Tamani foliar Objetivouse Objetivou se ITS TEF1α, TEF1α TEFα TEF 1α, 1α α TEF-1α yamadae cv 20 835 8 35 8,3 materiais 2 83 3 8,

Abstract Aerenchyma is a characteristic tissue of aquatic plants, characterized by the presence of air lacunae commonly septated by diaphragms. These are formed by one or more layers of stellate cells, which allow for the passage of gases. Most species of Eleocharis grow in wet or flooded soils and have aerenchyma in their aerial stems. However, extensive studies on this structure, which could contribute to ecological and phylogenetic studies of the group, are lacking. This work describes the structure of the diaphragm in the stem of Eleocharis species and investigates the evolution of this characteristic in the genus. Fifty-three species were analyzed under light and scanning electron microscopy. We analyzed the evolution of the characteristics by reconstructing their ancestral states based on the previously published original phylogeny. The diaphragms in Eleocharis vary mainly in the number of layers, cell shape, and cell wall thickness. The typical diaphragm of the genus is composed of three to four layers of stellate cells, with microprojections and secretory cells. The diaphragm of the group’s ancestor had practically the same characteristics as the genus’s typical diaphragm. plants cells gases stems However group lacking Fiftythree Fifty microscopy phylogeny shape thickness groups s genuss

Resumo Aerênquima é um tecido comum nas plantas aquáticas, caracterizado pela presença de lacunas de ar comumente septadas por diafragmas. Esses, são formados por uma ou mais camadas de células, geralmente braciformes, que permitem a passagem de gases. A maioria das espécies de Eleocharis cresce em solos úmidos ou inundados e apresenta aerênquima no caule. No entanto, essa estrutura carece de estudos amplos que poderiam contribuir aos estudos ecológicos e filogenéticos do grupo. Este trabalho descreve a estrutura do diafragma no caule de espécies de Eleocharis e investiga a evolução desse caractere no gênero. 53 espécies foram analisadas em microscopia de luz e eletrônica de varredura através de secções transversais e longitudinais do caule. A análise da evolução dos caracteres foi feita pela reconstrução de estado ancestral, baseada na filogenia original anteriormente publicada. Os diafragmas em Eleocharis variam principalmente em número de camadas, formato das células e espessura da parede celular. O diafragma típico do gênero é composto de três a quatro camadas de células braciformes lobadas, com microprojeções e células secretoras. O diafragma do ancestral do grupo apresentava praticamente as mesmas características do diafragma típico para o gênero. aquáticas Esses gases entanto 5 publicada celular lobadas secretoras

RESUMO Espécimes do gênero Diplostomum von Nordmann, 1832 (Trematoda, Diplostomidae) foram coletados do intestino da gaivota de arenque, Larus argentatus (Laridae), coletada no lago El-Manzala (cidade de Port Said, Egito). Essa espécie de parasita foi estudada morfometricamente e morfologicamente, bem como molecularmente, usando a região do gene espaçador transcrito interno (ITS1-5.8S-ITS2). A presença de uma espécie de trematoda de Diplostomum spathaceum Rudolphi, 1819 (Diplostomidae) foi observada em 70% das espécies de gaivotas examinadas. Essa espécie tem características genéricas do gênero Diplostomum. Os critérios distintos que discriminaram essa espécie das congêneres foram a divisão das partes do corpo, o corpo dianteiro em forma de ovo com comprimento menor do que o corpo traseiro, a ventosa ventral de tamanho menor do que a oral, a posição da ventosa ventral próxima ao suporte, a viterlária compacta e raramente estendida anteriormente ao órgão do suporte e o tamanho menor do ovo. As sequências parciais ITS1-5.8S-ITS2 de diplostomídeos recuperadas neste estudo mostraram que eles se agruparam com membros do gênero Diplostomum e formaram um grupo monofilético que apoia a descrição morfológica. Os resultados obtidos com a análise molecular são consistentes com os dados da classificação morfológica, em que o parasita registrado era morfologicamente semelhante ao Diplostomum spathaceum, com um primeiro registro em gaivotas egípcias. Nordmann 183 Trematoda, Trematoda (Trematoda Diplostomidae arenque Laridae, Laridae , (Laridae) ElManzala El Manzala cidade Said Egito. Egito . Egito) molecularmente ITS15.8SITS2. ITS158SITS2 ITSSITS ITS1 5.8S ITS2 5 8S ITS S (ITS1-5.8S-ITS2) Rudolphi 181 (Diplostomidae 70 examinadas traseiro oral ITS15.8SITS2 ITS1-5.8S-ITS morfológica egípcias 18 (Laridae ITS15 8SITS2 SITS ITS158SITS 58S (ITS1-5.8S-ITS2 7 ITS15.8SITS 1 8SITS (ITS1-5.8S-ITS

ABSTRACT Specimens of the genus Diplostomum von Nordmann, 1832 (Trematoda, Diplostomidae) were collected from the intestine of the herring gull, Larus argentatus (Laridae), from El-Manzala Lake (Port Said City, Egypt). This parasite species was morphometrically, morphologically, and molecularly studied using the internal transcribed spacer (ITS1-5.8S-ITS2) gene region. The presence of a trematode species of Diplostomum spathaceum Rudolphi, 1819 (Diplostomidae) was observed in 70 % of the examined gull species. This species has generic features of the genus Diplostomum. Distinct criteria that discriminated this species from congeners were the division for body parts, the egg-shaped forebody with a smaller length than the hind body, the ventral sucker being smaller in size than the oral one, the position of the ventral sucker being near to the holdfast, vitellaria was compact and rarely extend anteriorly to the holdfast organ, and smaller egg size. Partial ITS1-5.8S-ITS2 sequences from diplosomite recovered in this study showed that they grouped with members of the genus Diplostomum and formed a monophyletic group supporting the morphological description. Findings obtained from molecular analysis are consistent with data from morphological classification where the parasite recorded was morphologically similar to Diplostomum spathaceum with a first record in Egyptian gulls. Nordmann 183 Trematoda, Trematoda (Trematoda Diplostomidae Laridae, Laridae , (Laridae) ElManzala El Manzala Port City Egypt. Egypt . Egypt) morphometrically ITS15.8SITS2 ITS158SITS2 ITSSITS ITS1 5.8S ITS2 5 8S ITS S (ITS1-5.8S-ITS2 region Rudolphi 181 (Diplostomidae 7 parts eggshaped shaped one organ ITS1-5.8S-ITS description gulls 18 (Laridae ITS15 8SITS2 SITS ITS15.8SITS ITS158SITS 58S (ITS1-5.8S-ITS 1 8SITS

Abstract This article reports on a golden-billed saltator Saltator aurantiirostris Vieillot, 1817, kept in captivity outside its natural distribution area, in the proximities of the Itatiaia National Park, as a new host for Isospora similisi Coelho, Berto, Neves, Oliveira, Flausino & Lopes, 2013. Additionally, a supplementary molecular identification is provided through the sequencing of three non-overlapping loci of mitochondrial DNA and one locus of the 18S small subunit ribosomal RNA (18S) gene. All the taxonomic features of the I. similisi oocysts shed by S. aurantiirostris were equivalent to those originally described from Saltator similis d’Orbigny & Lafresnaye, 1837. The new sequenced loci were identical, or showed 99.9% similarity, to the samples of I. similisi from S. similis and S. aurantiirostris, confirming the same species from both hosts. Lastly, I. similisi is estimated as a junior synonym of Isospora formarum McQuistion & Capparella, 1992, due to the morphological similarities and wide distribution of its hosts in the Neotropical region. Therefore, this study encourages future taxonomic inquiries into I. similisi collected from other Saltator spp. in order to establish this synonymization of I. formarum with I. similisi, and hence, its wide distribution and dispersion in the Neotropical region, including across the Andes mountains. goldenbilled golden billed Vieillot 1817 area Park Coelho Berto Neves Oliveira Lopes 2013 Additionally nonoverlapping non overlapping S (18S gene I dOrbigny d Orbigny Lafresnaye 1837 identical 999 99 9 99.9 similarity Lastly Capparella 1992 region Therefore spp hence mountains 181 201 183 99. 199 18 20 19 1 2

Resumo Este artigo relata um bico-duro Saltator aurantiirostris Vieillot, 1817, mantido em cativeiro fora de sua área de distribuição natural, nas proximidades do Parque Nacional de Itatiaia, como novo hospedeiro de Isospora similisi Coelho, Berto, Neves, Oliveira, Flausino & Lopes, 2013. Adicionalmente, uma identificação molecular suplementar foi fornecida por intermédio do sequenciamento de três loci não sobrepostos de DNA mitocondrial e um locus da subunidade pequena do gene 18S do RNA ribossômico (18S). Todas os caracteres taxonômicos dos oocistos de I. similisi, eliminados por S. aurantiirostris, foram equivalentes àqueles originalmente descritos de Saltator similis d'Orbigny & Lafresnaye, 1837. Os novos loci sequenciados foram idênticos, ou tiveram 99,9% de similaridade, com as amostras de I. similisi de S. similis e S. aurantiirostris, confirmando a mesma espécie de ambos os hospedeiros. Por fim, I. similisi foi estimada como sinonímia júnior de Isospora formarum McQuistion & Capparella, 1992, devido às semelhanças morfológicas e ampla distribuição de seus hospedeiros na região Neotropical. Portanto, este estudo incentiva futuras investigações taxonômicas sobre I. similisi, recuperados de outros Saltator spp., a fim de estabelecer essa sinonimização de I. formarum com I. similisi e, consequentemente, sua ampla distribuição e dispersão na região Neotropical, inclusive Cordilheira dos Andes. bicoduro bico duro Vieillot 1817 natural Itatiaia Coelho Berto Neves Oliveira Lopes 2013 Adicionalmente S 18S. . (18S) I dOrbigny d Orbigny Lafresnaye 1837 idênticos 999 99 9 99,9 similaridade Capparella 1992 Neotropical Portanto spp spp. consequentemente Andes 181 201 (18S 183 99, 199 18 20 19 1 2

ABSTRACT: Cattle trypanosomiasis imposes significant economic burdens on the global livestock industry. The causative agents of this disease belong to the protozoan Trypanosoma genus. This study aims to perform detection (parasitological and molecular) and genetic characterization to analyze Trypanosoma spp. in cattle from 15 municipalities in the state of Rio de Janeiro, focusing on the 18S rDNA and Cathepsin-L (CatL) gene of Trypanosoma vivax and Trypanosoma theileri. A total of 389 blood samples from 15 dairy cattle farms in the state of Rio de Janeiro were collected, and DNA was extracted for subsequent PCR amplification of Trypanosoma spp. 18S rDNA and CatL genes. The resulting amplicons underwent sequencing and alignment for phylogenetic analysis, with comparisons made to GenBank isolates. Concerning parasitological analysis, blood smears presented 4.4% of positive cattle (n=17/389) for T. vivax and did not show any trypomastigote forms of T. theileri. The absolute frequency of Trypanosoma spp. through molecular detection targeting 18S rDNA was 11.6% (45/389). However, when performing species-specific PCRs, the T. vivax frequency, determined through CatL gene PCR, was 12.8%, and the T. theileri frequency was 3.6%. Phylogenetic analysis based on 18S rDNA revealed low diversity among T. vivax sequences, suggesting potential host segregation. This study emphasizes the high frequency of positive samples by PCR when compared to direct parasitological exams. Additionally, T. vivax phylogeny targeting 18S rDNA hints at sequence clustering related to host species. Importantly, this investigation unveils, for the first time in Rio de Janeiro’s cattle, the circulation of T. theileri lineage ThI, encompassing genotypes IIB and IF. This discovery expands our understanding of this parasite’s geographical distribution and genetic diversity. ABSTRACT industry genus spp 1 S CathepsinL Cathepsin L (CatL 38 collected genes isolates 44 4 4.4 n=17/389 n17389 n 17 (n=17/389 T 116 11 6 11.6 45/389. 45389 45/389 . 45 (45/389) However speciesspecific species specific PCRs 128 12 8 12.8% 36 3 3.6% sequences segregation exams Additionally Importantly unveils Janeiros s ThI IF parasites parasite 4. n=17/38 n1738 (n=17/38 11. 4538 45/38 (45/389 12.8 3.6 n=17/3 n173 (n=17/3 453 45/3 (45/38 12. 3. n=17/ n17 (n=17/ 45/ (45/3 n=17 n1 (n=17 (45/ n=1 (n=1 (45 n= (n= (4 (n (

RESUMO: A tripanossomíase bovina impõe significativos ônus econômicos à indústria pecuária global. Os agentes causadores dessa doença pertencem a protozoários do gênero Trypanosoma. Objetivou-se, com este estudo, realizar detecção (parasitológica e molecular) e caracterização genética de Trypanosoma spp. em bovinos de 15 municipalidades do estado do Rio de Janeiro, com foco na sequência 18S rDNA e no gene Cathepsin-L (CatL) de Trypanosoma vivax e Trypanosoma theileri. Um total de 389 amostras de sangue de 15 fazendas leiteiras no estado do Rio de Janeiro foram coletadas, e o DNA foi extraído para subsequente amplificação por PCR dos genes 18S rDNA e CatL de Trypanosoma spp. Os amplicons resultantes foram submetidos a sequenciamento e alinhamento para análise filogenética, com comparações realizadas com isolados do GenBank. No que se refere à análise parasitológica, os esfregaços de sangue apresentaram 4,4% de bovinos positivos (n=17/389) para T. vivax e não mostraram nenhuma forma tripomastigota de T. theileri. A frequência absoluta de Trypanosoma spp. através da detecção molecular visando 18S rDNA foi de 11,6% (45/389). No entanto, ao realizar PCRs específicos de espécies, a frequência de T. vivax, determinada por PCR do gene CatL foi de 12,8%, e a frequência de T. theileri foi de 3,6%. A análise filogenética com base no 18S rDNA revelou baixa diversidade entre as sequências de T. vivax, sugerindo uma possível segregação de hospedeiros. Este estudo enfatiza a alta frequência de amostra positiva pela PCR quando comparada com a parasitológica direta. Além disso, a filogenia de T. vivax direcionada ao 18S rDNA sugere agrupamento de sequências relacionado à espécie hospedeira. Importante destacar que esta investigação revela, pela primeira vez no gado do Rio de Janeiro, a circulação da linhagem ThI de T. theileri, abrangendo os genótipos IIB e IF. Esta descoberta amplia nosso entendimento sobre a distribuição geográfica e diversidade genética desse parasito. RESUMO global Objetivouse, Objetivouse Objetivou se, Objetivou-se spp 1 S CathepsinL Cathepsin L (CatL 38 coletadas GenBank 44 4 4,4 n=17/389 n17389 n 17 (n=17/389 T 116 11 6 11,6 45/389. 45389 45/389 . 45 (45/389) entanto espécies 128 12 8 12,8% 36 3 3,6% hospedeiros direta disso hospedeira revela IF parasito 4, n=17/38 n1738 (n=17/38 11, 4538 45/38 (45/389 12,8 3,6 n=17/3 n173 (n=17/3 453 45/3 (45/38 12, 3, n=17/ n17 (n=17/ 45/ (45/3 n=17 n1 (n=17 (45/ n=1 (n=1 (45 n= (n= (4 (n (