Abstract The Global South has witnessed increasing sampling of its immense biological diversity during the past century. However, the diversity of many regions remains unknown, even at pristine and highly threatened places, such as in the Atlantic Forest; and for bioindicator, umbrella, and flagship groups. The present study reports the first butterfly list of the Parque Estadual Intervales, São Paulo, Brazil and surroundings, a key protected area in the last massive continuous of the Atlantic Forest. We compiled data from museums and four years of field work, under three sampling methods. We also aimed at providing resources to support conservation efforts by analyzing 27 years of climatic data (detailed in the Supplementary Material, in English and in Portuguese), discussing our results also for non-academics, and producing scientific outreach and educational material. A companion article dealt with the experiences of science outreach and capacity development, and illustrated the butterfly catalogue of the species sampled in the park. We found 312 species that sum to 2,139 records. The museum had 229 species (432 records), and we sampled 142 species (1,682 individuals), in a total effort of 36,679 sampling hours (36,432 trap and 247 net and observation hours). The richest families were Nymphalidae (148 species) and Hesperiidae (100 species). Most species were sampled exclusively by active methods (79.8%), but other sources (passive sampling, citizen science, etc.) also found unique records. We found the highest diversity metrics from January to May, and we demonstrated that winter months had less richness and abundance. We illustrated the 20 species common to all regions, and listed those that were found more than seven months in the year, as well as the most abundant species in trap sampling, with forest dwellers as well as species common to open and fragmented areas. The dominant species in our trap datasets was the iridescent white morpho, Morpho epistrophus (Fabricius, 1796), and we suggest it to become the park butterfly mascot. century However unknown places Forest bioindicator umbrella groups Intervales Paulo surroundings work 2 detailed Material Portuguese, Portuguese , Portuguese) nonacademics, nonacademics non academics, academics non-academics material development 31 2139 139 2,13 records 22 432 (43 records, records) 14 1,682 1682 1 682 (1,68 individuals, individuals individuals) 36679 36 679 36,67 36,432 36432 (36,43 24 hours. . hours) 148 (14 100 (10 species. 79.8%, 798 79.8% 79 8 (79.8%) passive etc. etc May abundance year areas morpho Fabricius, Fabricius (Fabricius 1796, 1796 1796) mascot 3 213 13 2,1 43 (4 1,68 168 68 (1,6 3667 67 36,6 36,43 3643 (36,4 (1 10 79.8 7 (79.8% 179 21 2, 4 ( 1,6 16 6 (1, 366 36, 36,4 364 (36, 79. (79.8 17 1, (36 (79. (3 (79 (7

Resumo O Sul Global testemunhou crescente amostragem de sua imensa diversidade biológica durante o século passado. Entretanto, a diversidade de muitas regiões permanece desconhecida, mesmo em locais pristinos e altamente ameaçados, como na Mata Atlântica; e para grupos bioindicadores, guarda-chuva e emblemáticos. O presente estudo reporta a primeira lista de borboletas do Parque Estadual Intervales, São Paulo, Brasil e arredores, uma unidade de conservação chave no último maciço contínuo de Mata Atlântica. Compilamos dados de museus e quatro anos de campo, sob três métodos de amostragem. Também visamos oferecer recursos para apoiar os esforços de conservação, analisando 27 anos de dados climáticos (detalhados no Material Suplementar, em inglês e em português), discutindo nossos resultados numa linguagem também para não acadêmicos, e produzindo material de divulgação científica e educativos. Um artigo irmão tratou das experiências de divulgação científica e capacitação, e ilustrou o catálogo de borboletas das espécies amostradas no parque. Encontramos 312 espécies em 2.139 registros. O museu tinha 229 espécies (432 registros), e amostramos 142 espécies (1.682 indivíduos), em um esforço total de 36.679 horas de amostragem (36.432 armadilhas e 247 horas de rede e observação). As famílias mais ricas foram Nymphalidae (148 espécies) e Hesperiidae (100 espécies). A maioria das espécies foi amostrada exclusivamente por métodos ativos (79,8%), mas outras fontes (passiva, ciência cidadã, etc.) também encontraram registros únicos. Encontramos as maiores métricas de diversidade de janeiro a maio, e demonstramos que os meses de inverno tiveram menos riqueza e abundância. Ilustramos as 20 espécies comuns a todas as regiões, e listamos aquelas que foram encontradas em mais de sete meses no ano, bem como as espécies mais abundantes em armadilhas, com espécies florestais e também comuns em áreas abertas e fragmentadas. A espécie dominante em nossas armadilhas foi a morfo branca iridescente, Morpho epistrophus (Fabricius, 1796), e sugerimos que se torne a borboleta mascote do parque. passado Entretanto desconhecida ameaçados Atlântica bioindicadores guardachuva guarda chuva emblemáticos Intervales Paulo arredores campo 2 detalhados Suplementar português, português , português) acadêmicos educativos capacitação parque 31 2139 139 2.13 22 432 (43 registros, registros) 14 1.682 1682 1 682 (1.68 indivíduos, indivíduos indivíduos) 36679 36 679 36.67 36.432 36432 (36.43 24 observação. observação . observação) 148 (14 100 (10 espécies. 79,8%, 798 79,8% 79 8 (79,8%) passiva, passiva (passiva cidadã etc. etc únicos maio abundância ano fragmentadas iridescente Fabricius, Fabricius (Fabricius 1796, 1796 1796) 3 213 13 2.1 43 (4 1.68 168 68 (1.6 3667 67 36.6 36.43 3643 (36.4 (1 10 79,8 7 (79,8% 179 21 2. 4 ( 1.6 16 6 (1. 366 36. 36.4 364 (36. 79, (79,8 17 1. (36 (79, (3 (79 (7

ABSTRACT Describing dung beetle communities in tropical forest remnants located in disturbed/urbanized and conserved areas can provide information about the functioning of these ecosystems and support conservation plans. This study aimed to verify the effect of seasons and bait type on dung beetle communities in remnants of the Atlantic Forest in order to describe their composition and diversity parameters. The study was carried out during both the rainy and dry seasons in periurban and urban remnants. Eighteen pitfall traps baited with feces, carrion, and injured millipedes were established in each site. A total of 3501 individuals and 23 species were recorded. Urban remnant presented higher abundance of individuals in the dry season. On the other hand, in periurban remnant the higher abundance was verified in the rainy season. The diversity was higher in the rainy season in both sites. In urban remnant, Coprophanaeus ensifer was found to be generalist regarding its choice of bait (feces and carrion). The use of injured millipedes as bait allowed the record of the predatory species Deltochilum alpercata. Among the types of bait used, the injured millipedes proved to be very effective, capturing a greater diversity of dung beetles during the rainy season in both remnants, and allowed the collection of specialized, necrophages, and generalists species. Therefore, we propose the use of mixed-bait sampling designs in inventories and surveys to increase the chances of sampling species with different traits or dietary preferences, which are often rare in collections.

Resumen Hicimos un muestreo de las mariposas de algunos bosques del municipio de Solano, departamento de Caquetá, en la Amazonia colombiana. La recolección de mariposas se llevó a cabo durante cuatro días consecutivos en cuatro localidades de estudio, utilizando trampas con atrayentes y redes de búsqueda activa. Cada localidad contó con 12 puntos de muestreo con distancia de 250 m entre puntos, para un recorrido total de tres kilómetros. Se recolectaron 487 individuos, pertenecientes a 110 especies, 80 géneros, 28 tribus, 17 subfamilias y seis familias. Las familias con mayores abundancias y número de especies fueron Nymphalidae, con 68.2 % (75 spp.), Riodinidae 11.8 % (13 spp.) y Pieridae 10 % (11 spp.). La subfamilia mejor representada fue Satyrinae (N=228), destacando la tribu Morphini (N=65). Se destacan el hallazgo de seis especies de Marpesia, la tercera parte de las especies descritas para el género, y el de Gunayan rubricollis, una especie rara en Colombia. La presente investigación confirma la diversidad de mariposas en bosques amazónicos, donde más del 40 % de las especies son indicadoras de buen estado de conservación de los bosques.

Abstract We sampled the butterfly community in the municipality of Solano, department of Caquetá, in Colombian Amazonia. The collection of butterflies was carried out during four consecutive days at four study locations, using bait traps and active search nets. Each location had 12 sampling points, with a distance of 250 m between points, for a total sampling length of three kilometers. We collected 487 individuals belonging to 110 species, 80 genera, 28 tribes, 17 subfamilies and six families. The families with the highest abundance and number of species were Nymphalidae, with 68.2 % (75 spp.), Riodinidae 11.8 % (13 spp.) and Pieridae 10 % (11 spp.). The best represented subfamily was Satyrinae (N=228), particularly the tribe Morphini (N=65). Remarkable findings include six species of Marpesia, one third of the species described for the genus, and Gunayan rubricollis, a rare species in Colombia. The present research confirms the diversity of butterflies in Amazon forests, where more than 40 % of the species are indicators of the forest’s good state of conservation.

RESUMEN En la zona productora de piña de Lebrija, Santander, una de las más grandes de Colombia, se seleccionaron cinco fincas y se realizó un muestreo de sinfílidos asociados al cultivo en los primeros meses en la variedad Perolera y el híbrido MD2. Se compararon dos métodos de recolección: i) método destructivo, con revisión de suelo alrededor de las raíces, y ii) método con trampas con cebo de trozos de papa mezclado con suelo. Estos dos métodos se implementaron en las mismas parcelas durante cinco muestreos bimensuales. Adicionalmente, se estimó el porcentaje de daño en raíces, definido como el porcentaje de raíces que muestran bifurcación por el daño de los sinfílidos. Todos los sinfílidos se identificaron como Hanseniella sp. El muestreo de sinfílidos basado en trampas subterráneas con cebo de papa requiere menos muestras para estimar la densidad poblacional, y es un predictor del daño en las raíces, mientras que el método destructivo no lo es. De esta manera, el muestreo con trampas podría ser una herramienta útil para el monitoreo y manejo de sinfílidos en piña. La abundancia se correlacionó con la humedad del suelo y no con el pH del suelo.

ABSTRACT In the pineapple growing region of Lebrija, Santander, one of the largest such regions in Colombia, five farms were selected, and a sampling of symphylids associated with this crop was carried out in the first months of cultivation in the variety Perolera and hybrid MD2. Two collecting methods were compared: i) the destructive method, with soil inspection around the roots, and ii) the bait-trap method with pieces of potato mixed with soil. These two methods were implemented in the same plots during five bimonthly samplings. Additionally, the percentage of root damage was estimated, defined as the percentage of roots that show bifurcation due to the damage caused by symphylids. All symphylids were identified as Hanseniella sp. Sampling of symphylids based on underground potato bait traps requires fewer samples to estimate population density and is a predictor of root damage while destructive sampling is not. Consequently, trap sampling could be a useful tool for monitoring and managing symphylids on pineapple. The abundance was related to soil moisture, and not to soil pH.

Freshwater crayfish are damaging invaders across southern Africa; however, monitoring techniques and efforts are disparate across the region as different sampling methods have been used. To develop a standard method for assessing redclaw crayfish Cherax quadricarinatus abundance, a survey was conducted to assess for differences in detection and catch per unit effort (CPUE) in Lake Kariba. Two sampling approaches were compared: opera traps baited with cooked maize meal historically used in crayfish surveys in Zimbabwe, and Promar collapsible traps baited with dry dog food, which have been used for assessments in South Africa and Swaziland. Baits were compared in the Barotse Floodplain in Zambia using the Promar trap. Detection probability (Pcapture) and CPUE were significantly lower for opera traps baited with cooked maize meal (Pcapture = 0.41; CPUE = 1.19 ± 0.24 ind.•trap -1•night -1) compared to the Promar traps baited with dry dog food (Pcapture = 0.67; CPUE = 4.53 ± 0.82 ind•trap -1•night -1). The Pcapture and CPUE for Promar traps baited with dog food (Pcapture = 0.89; CPUE = 4.29 ± 0.83 ind•trap-1•night -1) was significantly higher than for maize meal baited traps (Pcapture = 0.29; CPUE = 0.25 ± 0.17 ind•trap -1•night -1). Sex ratio and carapace length of crayfish sampled did not differ between sampling methods. Due to higher CPUE, the authors consider the Promar collapsible trap baited with dog food approach as the better method for determining crayfish population abundance and suggest that comparisons of abundance take this into consideration by applying conversion factors if different methods are applied.

Resumo: Objetivo O estudo comparou a eficiência de duas iscas (minhoca e coração de boi) no monitoramento da abundância do mandi (Pimelodus maculatus) no canal de fuga de barragens hidrelétricas, um dos peixes mais frequentemente mortos por manobras de turbinas. Métodos As amostragens foram bimestrais, de fevereiro de 2014 a dezembro de 2015, nas usinas hidrelétricas de Camargos e Itutinga, rio Grande, bacia do alto rio Paraná, usando anzóis iscados com minhoca e coração de boi. Usamos modelos lineares generalizados para testar a influência da usina hidrelétrica, tipo de isca, vazão defluente, temperatura, transparência e oxigênio dissolvido da água na abundância calculada pela captura por unidade de esforço de mandis. Resultados A maioria dos mandis (73%) foi capturada usando minhoca, mas as capturas por unidade de esforço verificadas para as duas iscas mostraram o mesmo padrão de variação sazonal nas duas usinas. Em ambas as usinas, os mandis capturados com minhoca foram menores que aqueles capturados com coração de boi, e a temperatura da água foi a única variável ambiental significativamente associada à abundância de mandis. Conclusões As duas iscas são eficientes para monitorar variações sazonais na abundância do mandi, que é influenciada apenas pela temperatura da água. Monitorar a abundância do mandi no canal de fuga pode auxiliar na redução da mortalidade de peixes, programando manobras arriscadas de turbinas para períodos de menor abundância do mandi.

Abstract: Aim This study compared the efficiency of two baits (earthworm and cow heart) for monitoring the abundance of mandi catfish (Pimelodus maculatus) in the tailrace of hydropower dams, one of the commonly killed fish in turbine procedures. Methods Sampling occurred every two months from February 2014 to December 2015 at the Camargos and Itutinga hydropower dams, located in the upper Paraná River basin, using hooks baited with earthworm and cow heart. We used generalized linear models to test the influence of dam, bait type, dam outflow discharge, water temperature, transparency, and dissolved oxygen on mandi abundance, calculated as catch per unit effort. Results Most mandi (73%) were caught using earthworms but catch per unit effort of mandi for both baits showed the same pattern of seasonal variation at each dam. At both dams, individuals of mandi sampled using earthworms were smaller than those sampled using cow heart, and water temperature was the only environmental variable significantly associated with the catch per unit effort of mandi. Conclusions Both baits are efficient to monitor seasonal variations in mandi abundance, which is influenced by water temperature. Monitoring the abundance of mandi in the tailrace can help minimizing fish mortality by scheduling risky turbine procedures for periods of lower mandi abundance.

ABSTRACT Due to the important ecological role of Nymphalidae as consumers of fermented fruits, excrement, exudates of decomposed plants and animals, as well as bioindicators of environmental quality that attract the interest of the general public, this study aimed to characterize the fauna of frugivorous butterflies at the Serra Azul State Park - PESA (Mato Grosso, Brazil) with regards to composition, taxonomic richness and spatial distribution. Collections were carried out in 2014 from six 250 m plots in a RAPELD module (5x5 km). We defined five sampling points in each plot and placed a Van Someren-Rydon trap (VSR), with a bait made from banana fermented in cane juice, positioned 1 m above the ground for 24 hours. We collected 204 specimens of Nymphalidae from five subfamilies, 22 genera, and 40 species. Satyrinae was the most abundant and species-rich subfamily. The community structure varied spatially, with the gallery forest presenting the greatest richness, diversity, and equitability, while ‘cerrado ralo’ presented higher abundance and less diversity and equitability. Therefore, according to the pattern of abundance in the PESA, species were best adapted to the log series model. Yphthimoides renata (Stoll, 1780) (Satyrinae), Hamadryas feronia (Linnaeus, 1758), and Callicore sorana (Godart, 1824) (Biblidinae) were the most abundant species, 19 species were singletons, and eight were doubletons. Richness estimators showed that 63% of all species were sampled. Our results indicate that the frugivorous butterfly community is structured according to phytophysiognomies, and the dominance of species that are tolerant to disturbances indicates landscape fragmentation within the PESA, which interferes with species substitution pattern and their abundances in different environments of the park.

RESUMO Áreas de preservação permanente contribuem para a recuperação de ambientes impactados e Formicidae representa um grupo potencialmente bioindicador, utilizado para descrever a complexidade estrutural de habitat. Assim, neste contexto, este estudo objetivou caracterizar a diversidade das assembleias de formigas que ocorrem em sítios com diferentes históricos de uso do solo na APP do reservatório da UHE Foz do Chapecó, bem como avaliar a similaridade das assembleias de formigas segundo os sítios amostrados. A amostragem foi realizada no mês de janeiro de 2017 em cinco sítios, três em Santa Catarina e dois no Rio Grande do Sul. Foram utilizados pitfall, guarda-chuva entomológico, isca de sardinha, isca de glicose e coleta manual. As assembleias foram caracterizadas e comparadas através da riqueza, abundância, diversidade de Shannon-Weaver (H’), Equitabilidade (J’) e estimativas de riqueza (Chao 1). Ao todo foram amostradas 101 espécies. A média das estimativas indicou que a riqueza pode ser 86,7% maior que a amostrada, enquanto os parâmetros de diversidade indicaram diferenças entre as assembleias. Os índices de diversidade mostraram divergência de 39,7% entre as assembleias com maior e menor diversidade. A riqueza observada neste estudo reitera o potencial de utilização das formigas como bioindicadoras do estado de conservação ambiental, acrescenta informações importantes sobre a riqueza e a ocorrência de formigas para a região e apresenta, sobretudo, um inventário das espécies de formigas presentes em uma área de APP, em processo de regeneração, que poderá servir de parâmetro para avaliações subsequentes.

ABSTRACT Permanent preservation areas contribute to the recovery of impacted environments and Formicidae is a potentially bioindicator group, used to describe the structural complexity of habitats. In this context, the study aimed to characterize the diversity of ant assemblages that occur in sites with different soil use history in the APP of Foz do Chapecó HPP reservoir, as well as to evaluate the similarity of ant assemblages according to the sampled sites. Sampling was carried out in January 2017 at five sites, three in Santa Catarina state and two in Rio Grande do Sul state. Pitfall, entomological umbrella, sardine bait, glucose bait and manual collection were used. Assemblies were characterized and compared through richness, abundance, diversity of Shannon-Weaver (H’), Equitability (J’) and estimated richness (Chao 1). A total of 101 species were sampled. The average of the estimates indicated that richness may be 86.7% greater than that sampled, while the diversity parameters indicated differences between the assemblies. Diversity indices showed divergence of 39.7% between the more and less diverse assemblies. The richness observed in this study reiterates the potential of the use of ants as bioindicators of the state of environmental conservation, adds important information on the richness and occurrence of ants for the region and presents, above all, an inventory of the species of ants present in an area of APP in a regeneration process that can serve as parameter for subsequent evaluations.

Resumen El objetivo de esta investigación fue determinar la densidad poblacional de Rhodnius prolixus y de sus estadios de desarrollo, en bosques naturales de Attalea butyracea a lo largo de un periodo hidrológico, en ecosistemas de sabana inundable de la Orinoquia colombiana. Se muestrearon 120 palmas durante un año, usando trampas cebo vivo para Triatominae. Se halló que R. prolixus presenta alta densidad poblacional durante todo el año; que aumenta en época de bajas lluvias y disminuye en los meses de mayor precipitación. También se encontró que todos los estadios de desarrollo están presentes durante todo el año, aunque con diferencias en su representatividad, mostrando una disminución de la densidad a medida que aumenta la etapa de desarrollo. Por otra parte, se observaron altos índices de infestación, colonización y agrupamiento. Lo anterior sugiere que la especie presenta estabilidad de sus poblaciones en bosques de A. butyracea a pesar de la época climática, además de éxito reproductivo y, por ende, con individuos en capacidad de dispersión y colonización de otros micro hábitats en cualquier momento sin importar la condición climática.

Abstract The objective of this study was to determine the population density of Rhodnius prolixus and its developmental stages in natural forests of Attalea butyracea during a hydrological period in flooded savanna ecosystems of the Colombian Orinoquia region. One hundred twenty (120) palms were sampled over a period of one year using live bait traps for Triatomine bugs. Sampling showed that R. prolixus presents a high population density throughout the year, which increases during periods of low rainfall and decreases during the months of greatest precipitation. It was also found that all developmental stages of R. prolixus are presented throughout the year, although there are differences in their representation; showing decreases in density as developmental stages advance. Additionally, infestation, colonization and clustering were observed. The above suggests that the species presents population stability in A. butyracea forests without regard to climatic period, as well as reproductive success; thus individuals have the capacity to disperse and colonize other microhabitats at any time, regardless of climatic condition.

Polylepis woodlands are vulnerable ecosystems that are under strong anthropogenic pressure. These woodlands are fragmented, forming patches on the slopes of high andean and rocky mountains, where we find Polylepis tomentella. They are distributed in the departments of Ayacucho, Apurimac and Arequipa. In 2010, we evaluated the community structure of the order Coleoptera in a representative patch of the Chaviña district. Two surveys (wet and dry season) were carried out. Ten sampling stations were established and pitfall traps, bait traps, chromotropic traps, active collection and Malaise traps were used. Forty-five species were identified and distributed in 18 families, being Curculionidae and Carabidae the most representative. Estimated richness was between 43 and 47 species. The best richness estimator was ACE. These data can be useful for subsequent diversity studies and also to estimate the degree of disturbance of these woodlands.

Los bosques de Polylepis son ecosistemas vulnerables que están bajo una presión antropogénica fuerte. Se encuentran fragmentados y forman parches en laderas de montañas y roquedales altoandinos. Allí se sitúan los bosques de Polylepis tomentella, distribuidos en los departamentos de Ayacucho, Apurímac y Arequipa. En el año 2010, se evaluó la estructura comunitaria del orden Coleoptera en un parche representativo del distrito de Chaviña. Se realizaron dos evaluaciones (época húmeda y seca) en las que se establecieron diez transectos de muestreo y se emplearon trampas de caída, trampas con cebo, trampas cromotrópicas, colecta activa y trampas Malaise. Se identificaron 45 especies distribuidas en 18 familias, de las cuales Curculionidae y Carabidae fueron las más representativas. La riqueza estimada osciló entre 43 y 47 especies. El mejor estimador de la riqueza fue ACE. Los datos se pueden usar para estudios posteriores de diversidad y también para estimar el grado de perturbación de estos bosques relictos.

RESUMO Este estudo foi o primeiro a avaliar a eficiência de métodos de captura de pequenos mamíferos não-voadores na Floresta Nacional de Carajás, sudeste da Amazônia brasileira. É uma área que apresenta características fitofisionômicas exclusivas (savana metalófila ou Canga) e sofre pressão da atividade mineradora. Os objetivos desse estudo foram comparar a eficiência de dois métodos de captura e de três tipos de iscas, bem como se a eficiência dos métodos variou sazonalmente. Nós usamos quatro grades de amostragem, cada uma com seis trilhas paralelas. Capturas com armadilhas de gaiola (live-traps) e armadilhas de caída (pitfall traps) foram realizadas durante três estações secas e três úmidas. O esforço total de captura foi de 51.840 armadilhas*noite e 10.800 baldes*noite para live-traps e pitfalls, respectivamente. Três tipos de isca (pasta de amendoim com sardinha, bacon e banana) foram usadas de forma alternada em todas as armadilhas. Nós registramos 26 espécies de pequenos mamíferos, 11 da ordem Didelphimorphia e 15 da ordem Rodentia. Pitfalls capturaram mais espécies que live-traps. As taxas de captura e de mortalidade e a proporção de jovens e adultos não diferiram entre os métodos. O sucesso de captura diferiu sazonalmente apenas para pitfalls. A maioria das espécies foi capturada preferencialmente ou exclusivamente por um dos dois métodos. As espécies foram igualmente atraídas por todos os tipos de iscas. Nossos resultados diferiram de outros obtidos na Amazônia, o que deve ser levado em consideração em desenhos amostrais para pequenos mamíferos na região.

ABSTRACT This study was the first to evaluate the efficiency of trapping methods in the study of small mammals in the Carajás National Forest, southeastern Brazilian Amazon. It is an area with a unique vegetation type (metalofilic savannah or Canga). The aims of this study were to compare the efficiency of two trapping methods (i.e. live-traps and pitfalls), the bait types used, and evaluate if trapping success varied seasonally. We used four sampling grids, each with six parallel transects. The trap effort for live-traps and pitfalls was 51,840 trap*nights and 10,800 bucket*nights, respectively. We used three types of bait: a paste of peanut butter and sardines, bacon, and bananas. We placed one type of bait in each trap, alternating between points. We recorded 26 species of small mammals, 11 from the order Didelphimorphia and 15 from the order Rodentia. Pitfalls captured a higher number of species compared with live-traps. The capture rate, the mortality rate and the quantity of juveniles and adults did not differ significantly between methods. Capture rate for pitfalls differed significantly between seasons. The majority of species were captured by a single method. Species were equally attracted to the traps regardless of the type of bait used. Some of our results differed significantly from other studies in Amazonia and such variation should be taken into account when designing survey methods for Amazonian small mammals.

RESUMO A doença de Petri causada, principalmente, por Phaeomoniella chlamydospora e espécies de Phaeoacremonium é grave, complexa, ataca plantas jovens de videira e é de difícil controle no mundo. No Brasil, o estado de São Paulo está entre os maiores produtores da uva ‘Niagara Rosada’ e não há relato oficial desta doença no estado. Assim, os objetivos do presente trabalho foram avaliar a incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo e comparar metodologias para isolar os agentes causais da doença. O delineamento foi inteiramente casualizado, testando-se três meios de isolamento [ágar-água (AA), batata dextrose ágar (BDA) e isca de maçã-verde], com amostras de plantas doentes desinfestadas ou não, nove localidades de coleta e oito repetições (placa de Petri com os meios e quatro fragmentos das plantas por amostra). Anotou-se o número de colônias dos agentes causais por fragmento por placa de cada meio de cultura por localidade. Identificaram-se os isolados dos fungos obtidos por extração de DNA e sequenciamento da região ITS-5.8S do rDNA [ITS1 TCCGTAGGTGAACCTGCGG e ITS4 TCCTCCGCTTATTGATATGC] e partes dos genes da alfa elongase [EF1 ATGGGTAAGGARGACAAGAC e EF2 GGARGTACCAGTSATCATGTT] e da beta tubulina [Bt2a GGTAACCAAATCGGTGCTGCTTTC e Bt2b ACCCTCAGTGTAGTGACCCTTGGC]. Teste de patogenicidade foi feito com um isolado de Phaeomoniella spp. e um de Phaeoacremonium spp. A incidência e a severidade da doença (comprimento das estrias escuras no sistema vascular) foram avaliadas. Os municípios de Louveira B, Vinhedo, Jundiaí, Jarinú, Porto Feliz, São Miguel Arcanjo e Jales foram os que apresentaram a presença dos agentes causais da doença, demonstrando ocorrência da doença de Petri em todo o estado de São Paulo. A espécie de Phaeoacremonium prevalente foi P. minimum (= P. aleophilum). Somente na cidade de Jales, além de P. minimum detectou-se, também, a espécie P. venezuelense. Phaeomoniella chlamydospora foi a única espécie identificada neste gênero. A porcentagem de isolamento foi maior para P. chlamydospora do que para Phaeoacremonium spp. O isolamento dos agentes causais da doença deve ser feito retirando fragmentos do sistema vascular da região do colo das plantas sintomáticas seguido de desinfestação superficial e plaqueamento de fragmentos em meio de cultura BDA. Incuba-se em BOD, a 23ºC, por até 21 dias. O método de isca e depois repicagem para BDA não permitiu isolar nenhum dos agentes causais da doença. Todas as plantas inoculadas desenvolveram sintomas externos e internamente a média do comprimento das estrias escuras para P. chlamydospora foi de 7,9 cm e de P. minimum foi de 5,2 cm. As plantas controle (testemunha) permaneceram sadias. Os fungos foram re-isolados das plantas doentes, completando os postulados de Koch e oficializando a doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil.

ABSTRACT The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.

RESUMO Objetivou-se com este trabalho identificar e quantificar a infestação de espécies de moscas-das-frutas e seus parasitoides, associadas a 20 genótipos de cajazeira (Spondias mombin L.) em um pomar comercial no município de Teresina-PI. Frutos caídos foram coletados, e armadilhas com atrativo alimentar foram instaladas no pomar, no período de janeiro a dezembro de 2012. Foram coletados 6.560 frutos (79, 58 kg), obtendo-se 23.059 pupários, dos quais emergiram 10.080 moscas-das-frutas do gênero Anastrepha e 4.984 parasitoides braconídeos. A espécie A. obliqua foi a predominante, com 99, 92 %. Os genótipos F16P13 e F11P10 apresentaram maiores índices de infestação, e os genótipos F15P11 e F04P01, os menores. Os principais parasitoides coletados foram Opius bellus (77, 65 %), Doryctobracon areolatus (19, 88 %) e Utetes anastrephae (2, 47 %). O índice de parasitismo médio entre os genótipos foi de 30, 46 %. Nas armadilhas, foi coletado um total de 1.434 moscas-das-frutas, cujas espécies encontradas foram: A. obliqua, (97, 6 %), A. serpentina (1,4 %), A. fraterculus (0,4 %), A. striata (0,4 %), A. dissimilis (0,1 %), A. pseudoparallela (0,1 %). A espécie A. obliqua foi a predominante na área, com base na análise faunística calculada. O índice de infestação no pomar foi relevante durante cinco meses (janeiro a maio), período de disponibilidade de frutos de cajazeira. Houve uma correlação significativa negativa entre o número de moscas-das-frutas no pomar e a temperatura média do ar, e correlação significativa positiva com a precipitação pluviométrica e umidade relativa do ar. Entretanto, o principal fator constatado que influenciou o índice de infestação no pomar de cajazeira foi à disponibilidade de frutos.

ABSTRACT The aim of this work was to identify and quantify the infestation of fruit fly species and their parasitoids, associated with 20 hog plum genotypes (Spondias mombin L.) in a commercial orchard in Teresina, Piauí, Brazil. The survey was conducted by fruit sampling and monitoring through traps stocked with bait food, in the period from January to December 2012. Overall, 6560 fruits were collected (79.58 kg), resulting in 23059 pupae, of which 10080 fruit flies of the genus Anastrepha and 4984 braconid parasitoids emerged. Anastrepha obliqua species was the predominant with 99.92%. F16P13 and F11P10 genotypes had the highest infestation indexes and F15P11 and F04P01 genotypes, the lowest. The main parasitoids collected were Opius bellus (77.65%), Doryctobracon areolatus (19.88%) and Utetes anastrephae (2.47%). The average parasitism rate among genotypes was of 30.46%. In traps, a total of 1434 fruit flies were collected, whose species were: A. obliqua (97.6%), A. serpentina (1.4%), A. fraterculus (0.4%), A. striata (0.4%), A. dissimilis (0.1%), A. pseudoparallela (0.1%). Anastrepha obliqua species was predominant in the area, based on faunistic analysis. The infestation index in the orchard was relevant for five months (January-May), coinciding with the period of availability of hog plum fruits, reaching the highest peak in March (2.86 FAT). There was a significant negative correlation between number of fruit flies in the orchard and the average air temperature, and a significant positive correlation with rainfall and relative humidity. However, the main factor that influenced the observed infestation index in the hog plum orchard was fruit availability.

Scarabaeinae dung beetles play a fundamental role in the tropical ecosystem dynamics. Thus, it is important to study their seasonal variations in the amazon floodplain. Our main goal was to identify variations in richness, abundance and community structure in Scarabaeinae (Coleoptera: Scarabaeidae) dung beetles in two seasons (wet and dry), comparing two kinds of baits. Collections were made in both seasons (dry and rain) using human feces and putrid fish as bait traps. A total of 16 422 specimens belonging to 39 species: 14 431 belonging to 35 species in the rainy season and 1 991 specimens belonging to 28 species in dry season were found. Dominant species were Ontophagus haematopus Harold 1875, Canthon quinquemaculatus Castelnau 1840, and Canthon aequinoctialis Harold 1868. Abundance compared between the two seasons and two kinds of baits, using the generalized linear model (GML), showed statistically significant differences. Otherwise, richness did not show significant difference. Analysis of similarity (ANOSIM), using the multidimensional scaling method (MDS), showed a significant difference of the composition of dung beetles community in the two seasons, as well as between the two kinds of baits. The species accumulation curve showed optimal sampling efforts, with more of 94% of expected species. We found a pronounced fluctuation of the dung beetles due to the temporality.

Los escarabajos Scarabaeinae cumplen un rol fundamental en la dinámica de los ecosistemas tropicales. Por ello, es importante conocer sobre su variación estacional en un bosque amazónico temporalmente inundable. Nuestro objetivo principal es conocer la variación de la riqueza, abundancia y composición de las comunidades de los escarabajos Scarabaeinae (Coleoptera: Scarabaeidae) en dos temporadas (lluvias y seca), comparandolos con dos tipos de cebos. Se efectuaron muestreos en ambas temporadas (seca e lluvias) empleando trampas de caída con dos tipos de cebos: fecas humanas y carroña de pescado. Se registraron 16 422 individuos pertenecientes a 39 especies: 14 431 pertenecientes a 35 especies en la temporada húmeda y 1 991 pertenecientes a 28 especies en la temporada seca. Las especies dominantes fueron Ontophagus haematopus, Canthon quinquemaculatus y C. aequinoctialis. Se registraron diferencias significativas en abundancia entre ambas temporadas y los dos tipos de cebo, usando el modelo lineal generalizado (GLM). Por lo contrario, en la riqueza no muestran diferencias significativas. El análisis de similitud (ANOSIM), usando el método de escalamiento multidimensional (MDS) mostró diferencias significativas en la composición de escarabajos Scarabaeinae entre las dos temporadas, así como entre los dos tipos de cebo. La curva de acumulación de especies mostró una estimación del 94% de las especies esperadas. Se encontró una fluctuación marcada en la abundancia de los escarabajos Scarabaeinae debido a la temporalidad.

Existe, en las últimas décadas, un aumento sustancial de literatura sobre estudios ecológicos que emplean trampas con cebo para capturar mariposas. El interés creciente por los estudios con trampas motivó un grupo exigente de estudiantes jóvenes e investigadores a la búsqueda de información y protocolos estandarizados. Con base en lo anterior, esta revisión tiene como objetivo discutir (i) los aspectos básicos de los principales métodos, y (ii) soluciones alternas de los diferentes estudios con trampas en el Neotrópico. Además se discuten los errores comunes que pueden disminuir la calidad y comparación de los resultados.

In the last decades, there has been a considerable increase in literature concerning ecological studies employing bait traps to capture butterflies. The growing interest in this kind of studies has given rise to a demanding group of young students and researchers looking for information and standardized protocols. Due to such growing interest in bait trap studies, this review aims to discuss (i) the basic aspects of the main technique of collection and sampling methods, and (ii) alternative solutions of different bait trap surveys in the Neotropics. Common mistakes that could undermine the quality and comparability of obtained data are also discussed.