RESUMO Objetivos Calcular a prevalência de sintomatologia depressiva pré-natal em grávidas de baixo risco, no termo da gestação, avaliar seus preditores e desfechos materno-fetais. Para tal, avaliar-se-á a aplicabilidade da Escala de Rastreio de Depressão Pós-Parto (PDSS 24) nessa fase da gravidez. Métodos A PDSS 24 e um questionário sociodemográfico, psicossocial e médico (antecedentes obstétricos e patológicos) foram autoaplicados a 403 grávidas (37-40 semanas de gestação), com idade média de 30,5 anos (DP = 4,67). Por meio do processo clínico, foram recolhidos dados de resultados materno-fetais. Resultados A PDSS 24 possui propriedades psicométricas adequadas para a deteção de sintomatologia depressiva pré-natal. A prevalência de sintomatologia depressiva pré-natal foi de 41,7%. Grávidas com níveis de escolaridade inferiores, não casadas, cuja gravidez não foi planejada e com antecedentes de acontecimentos de vida significativos apresentam risco duas vezes superior de sintomatologia depressiva no período pré-natal. Grávidas cujo apoio social percebido ao longo da gravidez não correspondeu ao desejado e com história prévia de depressão apresentam cerca de três vezes maior risco sintomatologia depressiva no período pré-natal. Para desfechos materno-fetais (pré-eclâmpsia, restrição de crescimento fetal, Apgar 1º/5º minuto, tipo de parto, percentil de peso, oligoâminos e necessidade de cuidados intensivos), as diferenças foram não significativas. Conclusão O rastreio da depressão pré-natal deve ser realizado na gravidez. Porém, no termo da gestação o uso da PDSS 24 como ferramenta de deteção de sintomatologia depressiva deve ser feito com cautela. A elevada prevalência de sintomas relacionados com o sono nessa fase da gestação pode conduzir ao sobre diagnóstico, usando a PDSS 24.

ABSTRACT Objectives The aims of the study were to estimate the prevalence of depressive symptomatology in full-term pregnancy (low risk), evaluate their predictors and maternal-fetal outcomes. To this end, the applicability of Postpartum Depression Screening Scale (PDSS 24) will be evaluated, at full-term pregnancy. Methods PDSS 24 and a sociodemographic, psychosocial, pathological and obstetrical background questionnaire were self-administered to 403 pregnant women (37-40 weeks gestation), with a mean age of 30.5 years (SD = 4.67). Data from maternal, fetal and neonatal outcomes were collected from the patient clinical process. Results PDSS 24 revealed adequate psychometric properties to screening depressive symptomatology in full-term pregnancy. The prevalence of depressive symptomatology was 41.7%. Pregnant women with lower study levels, who weren’t married, whose pregnancy was unplanned and with a previous history of significant life events present twice the risk to present depressive symptomatology. Pregnant women who hadn’t received the desired social support in pregnancy and with a history of depression present about a 3-fold increased risk to present depressive symptomatology. For maternal-fetal outcomes (pre-eclampsia, fetal growth restriction, Apgar score at 1st/5th minute, type of delivery, weight percentile, oligohydramnios and need for neonatal intensive care), the differences were not significant. Conclusion Screening for prenatal depression should be conducted during pregnancy. However, in full-term pregnancy women, the use of PDSS 24 as a screening tool for depressive symptomatology should be done with caution. The high prevalence of sleep-related symptoms, in full-term pregnancy, may lead to overdiagnosis, using PDSS 24.

RESUMO: As enzimas extracelulares estão envolvidas na patogênese de fungos em plantas. Atualmente, não há uma padronização de meios de cultura, formas de analisar e divulgar os dados de enzimas extracelulares produzidas em condições in vitro. Assim, o presente trabalho objetivou comparar os meios de cultura específicos relatados na literatura (normal) com o meio de batata-dextrose-ágar mais adição do substrato específico para produção de enzimas extracelulares por três diferentes fungos fitopatogênicos habitantes de solo (Fusarium solani f. sp. passiflorae, Sclerotium rolfsii e Rhizoctonia solani AG-4 HGI), bem como avaliar os dados das enzimas por cinco critérios diferentes. O delineamento experimental adotado foi o inteiramente ao acaso, em esquema de três fatores (meios, isolados e enzimas), com seis repetições. As enzimas investigadas foram amilase, carboximetilcelulase, lipase, lacase, catalase e gelatinase. Os meios normais detectaram mais enzimas, e essa detecção foi mais precisa em comparação com os meios de batata-dextrose-ágar mais o substrato específico. Os critérios que calcularam a área da coroa circular para as enzimas amilase, carboximetilcelulase, lipase e lacase e adotaram a escala de notas para medir a intensidade (0=ausência até 4=intensa) de catalase e gelatinase foram os melhores para avaliar e divulgar os resultados das enzimas. Assim, sugere-se padronizar os meios normais para estudos de produção de enzimas, bem como os critérios citados para avaliar e divulgar os dados das atividades das referidas enzimas.

ABSTRACT: Extracellular enzymes are involved in the fungal pathogenesis in plants. Currently, culture media, data analyses, and data report related to extracellular enzymes produced in vitro conditions are different and therefore, lack standardization. This work aimed to compare the culture media cited on the literature (normal) with the potato-dextrose-agar (PDA) medium combined with a specific compound to produce extracellular enzymes through three soilborne phytopathogenic fungi (F. solani f. sp. passiflorae, S. rolfsii, and R. solani AG-4 HGI), as well as to analyze and report enzyme data based on five different criteria. The assay was randomized, with three factors (culture media, isolates, and enzymes) and six repetitions. The studied enzymes were amylase (AM), carboxymethylcellulase (CMCase), lipase (LP), laccase (LC), catalase (CT), and gelatinase (GT). The normal media detected more enzymes and was more precise compared to the PDA medium plus specific compound. The criteria that calculated the area of the circular crown of AM, CMCase, LP, and LC and measured the intensity (0 = absence, up to 4 = intense) of CT and GT adopting note scale were the best to evaluate and report the results of the enzymes. We suggest the normal media culture to study enzyme production, as well as the criteria mentioned to assess and report the data related to enzyme activities.

RESUMO A doença de Petri é grave, complexa e de difícil controle em videiras no mundo. O principal agente causal desta doença é o fungo Phaeomoniella chlamydospora. Este fungo ocorre também na planta daninha de vinhedo Convolvulus arvensis. No Brasil, este fungo foi encontrado somente em videiras. Assim, o objetivo do presente estudo foi efetuar um levantamento fitossociológico de plantas daninhas em uma área com diferentes cavalos de videiras, em um campo de produção de mudas, em uma área experimental com videira e em diferentes áreas com plantio comercial de videira e verificar quais espécies poderiam estar hospedando o fungo P. chlamydospora. Para o levantamento fitossociológico das plantas daninhas, lançava-se um quadrado ao acaso, por dez vezes, no local, contando, identificando e amostrando todas as espécies. Para verificar as espécies hospedeiras do fungo, realizou-se isolamento do tecido vascular das plantas em meios de cultura e extração de DNA do mesmo tecido vegetal seguido de PCR com primers específicos do fungo do gene do fator de elongação (Pchlamy-EF-F 5’-CTCATTATCACATTTTGCTGC-3’ e Pchlamy-EF-R 5’-GAGAACAGTCAGTGATGAGC-3’). Em todo o levantamento, foram detectadas 46 espécies de plantas daninhas em 17 famílias, destacando-se as famílias Asteraceae e Poaceae com o maior número de espécies cada. Não foi detectado de maneira convencional e nem molecularmente o fungo P. chlamydospora infectando plantas daninhas, ressaltando a ocorrência da doença de Petri apenas em videiras.

ABSTRACT Petri disease is serious, complex and difficult to control in vines worldwide. The main causal agent of this disease is the fungus Phaeomoniella chlamydospora. This fungus also occurs in the vineyard weed Convolvulus arvensis. In Brazil, this fungus was found only in grapevines. Thus, the aim of the present study was to carry out a phytosociological survey of weeds in an area with different vine rootstocks, as well as in a field of seedlings production, in an experimental area with vines and in different areas with commercial vineyards, besides verifying which weed species could be hosting the fungus P. chlamydospora. For the phytosociological survey of weeds, a square was randomly cast ten times at the site, followed by counting, identification and sampling of all species. To verify host species of the fungus, vascular tissue of plants was isolated in culture media and DNA extraction from the same plant tissue was carried out followed by PCR with specific primers of the fungus for the elongation factor gene (Pchlamy-EF-F 5’-CTCATTATCACATTTTGCTGC-3’ and Pchlamy-EF-R 5’-GAGAACAGTCAGTGATGAGC-3’). Considering all surveyed fields, 46 weed species were detected in 17 families, especially Asteraceae and Poaceae, which had the largest number of species. Using conventional or molecular methods, the fungus P. chlamydospora was not detected infecting weeds, which highlights that Petri disease occurs only in grapevines.

BACKGROUND Paracoccidioidomycosis (PCM) is one of the most important systemic mycoses in Latin America and the leading fungal cause of mortality in non-immunosuppressed individuals in Brazil. However, HIV/PCM co-infection can increase the clinical severity in these co-infected patients. This co-infection is rarely reported in the literature mainly because of the different epidemiological profiles of these infections. Furthermore, PCM is a neglected and non-notifiable disease, which may underestimate the real importance of this disease. The advent of molecular studies on the species of the genus Paracoccidioides has expanded the knowledge regarding the severity and the clinical spectrum in PCM. In this context, the development of studies to describe the association of the Paracoccidioides phylogenetic cryptic species in vulnerable populations, such as HIV-infected patients, appears relevant. OBJECTIVE To describe the clinical, epidemiological, therapeutic and prognostic aspects in HIV/PCM co-infected patients, along with the molecular identification of the Paracoccidioides species involved in these cases. METHODS The investigators performed a molecular and clinical retrospective study involving HIV/PCM co-infected patients, from a reference centre for PCM care in the endemic area of Rio de Janeiro, Brazil, from 1998 to 2015. Molecular identification of the fungal strains was done by amplification of partial sequences of arf and gp43 genes. FINDINGS Of 89 patients diagnosed with PCM by fungal isolation in the culture, a viable isolate was recovered for molecular analysis from 44 patients. Of these 44 patients, 28 (63.6%) had their serum samples submitted for enzyme immunoassay tests for screening of HIV antibodies, and 5 (17.9%) had a positive result. All cases were considered severe, with a variable clinical presentation, including mixed, acute/subacute clinical forms and a high rate of complications, requiring combination therapy. Paracoccidioides brasiliensis S1 was the species identified in all cases. CONCLUSIONS HIV/PCM co-infection can change the natural history of this fungal disease. The authors reinforce the need to include HIV screening diagnostic tests routinely for patients with PCM.

RESUMO: A doença de Petri é complexa, ataca plantas jovens de videira e é difícil de ser controlada. O fungo Phaeomoniella chlamydospora é o principal agente causal dessa doença. Os objetivos deste estudo foram: avaliar o local prevalente dos fungos da doença de Petri, em diferentes partes de plantas de videira; avaliar a suscetibilidade de porta-enxertos de videira para o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre a desinfecção de estacas do porta-enxerto IAC 766 infectadas com o fungo P. chlamydospora; avaliar o efeito da solarização e da biofumigação seguido de tratamento com água quente sobre o enraizamento de estacas do porta-enxerto IAC 766. Para o teste de colonização, as espécies de fungos detectadas e identificadas em Niagara Rosada enxertada em dois porta-enxertos diferentes foram P. chlamydospora e Phialemoniopsis ocularis. Este é o primeiro relato de P. ocularis em parrerais jovens de videira no Brasil. Ambos os fungos, em particular P. chlamydospora, colonizaram somente a parte basal das plantas, destacando-se os porta-enxertos como foco para medidas de controle. Medidas das estrias escuras no sistema vascular revelaram que Golia foi o porta-enxerto menos suscetível, e o IAC 572 foi o mais suscetíveis para P. chlamydospora. Além disso, a biofumigação ou a temperatura de 37ºC aplicadas por 7 e 14 dias seguidas de tratamento com água quente eliminaram P. chlamydospora em estacas do porta-enxerto IAC 766 sem afetar o enraizamento. No entanto, novos estudos são necessários ainda para validar a eficiência dessas técnicas de desinfecção.

ABSTRACT: Petri disease is complex, attacks young vine plants and it is difficult to be controlled. The fungus Phaeomoniella chlamydospora (Phc) has been identified as the main causative agent of this disease. This study aimed to evaluate the prevalent colonization of the Petri disease fungi in different portions of vine plants; to assess the susceptibility of grapevine rootstocks to the fungus P. chlamydospora; to assess the effect of solarization and biofumigation, followed by hot-water treatment (HWT), on the disinfection of cuttings of the rootstock IAC 766 infected with P. chlamydospora, and assess the effect of solarization and biofumigation, followed by HWT, on the rooting of cuttings of the rootstock IAC 766. For the prevalent colonization test, the fungus species detected and identified in ‘Niagara Rosada’ grafted on two rootstocks different were Phc and Phialemoniopsis ocularis. This is the first report of P. ocularis in a young vineyard in Brazil. Both fungi, in particular Phc, colonized only the plant’s basal part, drawing attention to the rootstock as target for control measures. Measurement of the dark streaks in the vascular system revealed that Golia was the least susceptible rootstock, and IAC 572 was the most susceptible to Phc. Moreover, biofumigation or temperature of 37°C applied for 7 and 14 days, both followed by HWT, suppressed Phc in cuttings of the rootstock IAC 766 without hampering their rooting. Meanwhile, new studies are needed to validate the efficiency of these disinfection techniques.

RESUMO A doença de Petri causada, principalmente, por Phaeomoniella chlamydospora e espécies de Phaeoacremonium é grave, complexa, ataca plantas jovens de videira e é de difícil controle no mundo. No Brasil, o estado de São Paulo está entre os maiores produtores da uva ‘Niagara Rosada’ e não há relato oficial desta doença no estado. Assim, os objetivos do presente trabalho foram avaliar a incidência da doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo e comparar metodologias para isolar os agentes causais da doença. O delineamento foi inteiramente casualizado, testando-se três meios de isolamento [ágar-água (AA), batata dextrose ágar (BDA) e isca de maçã-verde], com amostras de plantas doentes desinfestadas ou não, nove localidades de coleta e oito repetições (placa de Petri com os meios e quatro fragmentos das plantas por amostra). Anotou-se o número de colônias dos agentes causais por fragmento por placa de cada meio de cultura por localidade. Identificaram-se os isolados dos fungos obtidos por extração de DNA e sequenciamento da região ITS-5.8S do rDNA [ITS1 TCCGTAGGTGAACCTGCGG e ITS4 TCCTCCGCTTATTGATATGC] e partes dos genes da alfa elongase [EF1 ATGGGTAAGGARGACAAGAC e EF2 GGARGTACCAGTSATCATGTT] e da beta tubulina [Bt2a GGTAACCAAATCGGTGCTGCTTTC e Bt2b ACCCTCAGTGTAGTGACCCTTGGC]. Teste de patogenicidade foi feito com um isolado de Phaeomoniella spp. e um de Phaeoacremonium spp. A incidência e a severidade da doença (comprimento das estrias escuras no sistema vascular) foram avaliadas. Os municípios de Louveira B, Vinhedo, Jundiaí, Jarinú, Porto Feliz, São Miguel Arcanjo e Jales foram os que apresentaram a presença dos agentes causais da doença, demonstrando ocorrência da doença de Petri em todo o estado de São Paulo. A espécie de Phaeoacremonium prevalente foi P. minimum (= P. aleophilum). Somente na cidade de Jales, além de P. minimum detectou-se, também, a espécie P. venezuelense. Phaeomoniella chlamydospora foi a única espécie identificada neste gênero. A porcentagem de isolamento foi maior para P. chlamydospora do que para Phaeoacremonium spp. O isolamento dos agentes causais da doença deve ser feito retirando fragmentos do sistema vascular da região do colo das plantas sintomáticas seguido de desinfestação superficial e plaqueamento de fragmentos em meio de cultura BDA. Incuba-se em BOD, a 23ºC, por até 21 dias. O método de isca e depois repicagem para BDA não permitiu isolar nenhum dos agentes causais da doença. Todas as plantas inoculadas desenvolveram sintomas externos e internamente a média do comprimento das estrias escuras para P. chlamydospora foi de 7,9 cm e de P. minimum foi de 5,2 cm. As plantas controle (testemunha) permaneceram sadias. Os fungos foram re-isolados das plantas doentes, completando os postulados de Koch e oficializando a doença de Petri na videira ‘Niagara Rosada’ no estado de São Paulo - Brasil.

ABSTRACT The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.

RESUMO O fungo Cylindrocladium spathiphylli causa podridão no colo e nas raízes de espatifilo. Fungos produzem enzimas extracelulares e muitas destas podem estar envolvidas na patogênese. Há poucos estudos procurando comprovar o papel de uma determinada enzima na patogênese, principalmente no patossistema C. spathiphylli e espatifilo. Assim, o objetivo do presente trabalho foi verificar a patogenicidade de diferentes isolados do fungo em espatifilo, em condições de BOD, e depois relacionar a patogênese com a produção in vitro da enzima extracelular lacase. O ensaio da patogenicidade foi inteiramente casualizado, com dois isolados normais e três isolados alterados por fungistase com seis repetições. Após a inoculação, avaliou-se a severidade da doença em mudas de espatifilo em quatro períodos (até 10 dias) com uma escala de notas (1,0 – sadia até 3,0 – morte de plantas). Aos 10 dias de avaliação, a severidade média da doença causada pelo isolado normal MMBF 01/01 e pelos isolados alterados MMBF 01/01 – 9 D e LFEEI016 – 3 D foi semelhante, enquanto que a severidade causada pelo isolado normal LFEEI016 não diferiu da testemunha. O isolado alterado MMBF 01/01 – 3 D apresentou severidade máxima da doença (nota média 3,0) aos sete dias de avaliação, diferindo dos demais. Quanto à enzima lacase, delineou-se ensaio inteiramente casualizado, com os mesmos isolados do fungo, em placa de Petri contendo meio específico para produção da enzima lacase com seis repetições. Mensurou-se a área da coroa circular da enzima formada no meio. A maior área média da enzima foi produzida pelo isolado alterado MMBF 01/01 – 3 D (2256,0 mm2), enquanto que as áreas dos isolados alterados LFEEI016 – 3 D e MMBF 01/01 – 9 D e do isolado normal MMBF 01/01 foram iguais e a menor área de lacase foi produzida pelo isolado normal LFEEI016 (747,2 mm2). Há uma relação quanto à quantidade da enzima lacase produzida in vitro com a severidade da doença causada pelos isolados na planta, o que reforça a necessidade de mais estudos in vivo para provar o papel da lacase na patogênese do fungo C. spathiphylli em espatifilo.

ABSTRACT The fungus Cylindrocladium spathiphylli causes collar and root rot in spathiphyllum. Fungi produce extracellular enzymes, most of which can be involved in pathogenicity. There are few studies that aim to prove the role of a certain enzyme in pathogenicity, especially for the pathosystem C. spathiphylli and spathiphyllum. Thus, the aim of the present study was to verify, under BOD conditions, the pathogenicity of different fungal isolates in spathiphyllum and to relate such pathogenicity to the in vitro production of the extracellular enzyme laccase. The pathogenicity assay was completely randomized with two normal isolates and three isolates altered by fungistasis, in six replicates. After inoculation, disease severity in spathiphyllum seedlings was evaluated at four different periods (until 10 days), using a score scale (1.0=health to 3.0=death of seedling). At 10 days, mean disease severity caused by the normal isolate MMBF 01/01 was similar to that caused by the altered isolates MMBF 01/01 – 9 D and LFEEI016 – 3 D, while the disease severity caused by the normal isolate LFEEI016 did not differ from that of control. The altered isolate MMBF 01/01 – 3 D showed maximum disease severity (average score 3.0) at seven days of evaluation, differing from the remaining isolates. As to the enzyme laccase, a completely randomized assay was designed with the same fungal isolates on Petri plate containing specific medium for laccase production, in six replicates. The area of the circular crown formed in the medium was measured. The largest mean area of the enzyme was produced by the altered isolate MMBF 01/01 – 3 D (2256.0 mm2), while the areas produced by the altered isolates LFEEI016 – 3 D and MMBF 01/01 – 9 D were equal to that produced by the normal isolate MMBF 01/01, and the smallest area of laccase was produced by the normal isolate LFEEI016 (747.2 mm2). In vitro production of the enzyme laccase was related to the disease severity caused by the isolates in the plant, which reinforces the need of further in vitro studies to prove the role of laccase in the pathogenicity of the fungus C. spathiphylli in spathiphyllum.

RESUMOOs fungos fitopatogênicos habitantes de solo causam perdas econômicas em muitas culturas e são difíceis de serem controlados. Esses fungos podem ser agrupados pelos sintomas comuns que causam nas plantas, bem como pelas enzimas extracelulares que podem produzir. O objetivo do trabalho foi verificar a produção in vitro de enzimas extracelulares por fungos de solo e tentar relacionar essas enzimas com os sintomas que cada fungo causa em planta hospedeira. O ensaio foi delineado em esquema inteiramente casualizado, com dois fatores, sete fungos (Cylindrocladium spathiphylli, Rhizoctonia solani, Sclerotium rolfsii, Ceratocystis fimbriata, Sclerotinia sclerotiorum, Fusarium oxysporum f. sp. dianthi e Verticillium dahliae) mais testemunha e seis enzimas (amilase, carboximetilcelulase, lipase, lacase, catalase e gelatinase) com 10 repetições. Catalase e gelatinase foram mensuradas por escala de notas, enquanto que as demais pelo cálculo da área da coroa circular. O ensaio foi repetido e a análise foi realizada com os dados de dois ensaios. Os fungos que causam podridão na raiz ou no colo da planta apresentaram maior produção de lacase, enquanto os que causam obstrução, fendas ou até a destruição do sistema vascular demonstraram a prevalência da lipase.

ABSTRACTSoilborne phytopathogenic fungi cause economical losses to several crops and are difficult to control. These fungi can be grouped according to the common symptoms they cause in plants, as well as to the extracellular enzymes they can produce. The aim of this study was to verify the in vitroproduction of extracellular enzymes for soilborne fungi and to relate these enzymes to the symptoms that each fungus causes in the host plant. The assay was conducted in completely randomized design, including two factors, seven fungi (Cylindrocladium spathiphylli, Rhizoctonia solani, Sclerotium rolfsii, Ceratocystis fimbriata, Sclerotinia sclerotiorum, Fusarium oxysporum f. sp. dianthi and Verticillium dahliae) plus control and six enzymes (amylase, carboxymethyl cellulase, lipase, laccase, catalase and gelatinase) with 10 replicates. Catalase and gelatinase were measured based on a score scale, while the other enzymes were analyzed by calculating the circular crown area (mm2). The assay was repeated twice and statistical analysis was done by using data of both assays. The fungi that cause root and collar rot presented greater laccase production, while those that cause obstruction, fissure and even destruction of the vascular system demonstrated prevalence of lipase.

O fungo Cylindrocladium spathiphylli causa podridão no colo e nas raízes de espatifilo, induzindo amarelecimento e murcha nas folhas da parte aérea. Há poucos estudos com o fungo quanto às enzimas extracelulares. Assim, delineou-se ensaio inteiramente casualizado in vitro, com três tratamentos (dois isolados normais: LFEEI016 - EPAGRI/SC e MMBF 01/01 - IB/SP; mais testemunha) e seis repetições, visando a detecção de enzimas. A amilase (AM), lipase (LP), carboximetilcelulase (CMC) e lacase (LC) foram mensuradas pelo cálculo da área da coroa circular, local de atividade das enzimas. A catalase (CT) e gelatinase (GL) foram mensuradas por símbolos, depois transformados em notas (1 a 4, de ausência à intensa produção). O isolado MMBF 01/01 produziu as maiores áreas e com mais intensidade as enzimas. Das enzimas, a maior área foi a da LC e depois a LP. LFEEI016 e MMBF 01/01 não apresentaram área para AM e CMC e exibiram intensidade fraca e igual para CT. A intensidade de GT foi moderada no MMBF 01/01 (nota média 3,0) e ausente para o LFEEI016 (nota média 1,0). Após a produção das enzimas extracelulares, os isolados foram alterados vegetativamente por temperatura. Instalou-se ensaio inteiramente ao acaso, em fatorial contendo disco de micélio dos isolados do fungo versus três temperaturas [23ºC (T1); 33ºC (T2) e de 33ºC para 23ºC (T3)] versus quatro períodos (3; 6; 9 e 12 dias), com oito repetições, em placa de Petri com BDA mantida em BOD. O diâmetro das colônias foi medido diariamente (mm) em dois sentidos. As alterações de temperatura vistas foram: inócuo, fungistático (FS) e fungicida (FC). Aplicou-se estatística nas temperaturas T1 e T3 dos isolados para checar efeito FS e escolher aqueles com maior e menor efeito. O isolado LFEEIO16 mostrou efeito FS com três dias às temperaturas 33ºC e de 33ºC para 23ºC. Nos demais períodos, o isolado sofreu efeito FC. O MMBF 01/01 mostrou efeito FS em todos os períodos. Ambos isolados sofreram, estatisticamente, efeito FS. O MMBF 01/01 mostrou maior efeito FS aos nove dias, nas temperaturas referidas e menor com três dias. Após a constatação de alteração na taxa de crescimento micelial dos isolados, procurou-se verificar, novamente, a produção de enzimas extracelulares. Os isolados alterados e utilizados foram o MMBF 01/01 com três e nove dias e o LFEEIO16 com três dias. A produção e a avaliação das enzimas foram realizadas da mesma maneira para os isolados normais. O isolado MMBF 01/01 - três dias produziu as maiores áreas e com mais intensidade as enzimas. Das enzimas, a maior área foi a da LC. Após LC, a área da LP foi maior que a da CMC nos isolados. Não se detectou área de AM nos isolados. A intensidade de GL foi maior que a da CT nos isolados MMBF 01/01 com três e nove dias. Para LFEEI016 - três dias, a intensidade média de CT foi nota 2,0 e ausência de GL (nota média 1,3). Sugere-se investigar a severidade da doença na planta entre os isolados e em condições naturais investigar a evolução da LC em comparação as demais enzimas na patogênese do fungo na cultura.

The fungus Cylindrocladium spathiphylli causes collar and root rot in spathe flowers, inducing yellowing and wilting of leaves in the shoot. This fungus has been scarcely studied for extracellular enzymes. Therefore, an in vitro assay was carried out in randomized design, with three treatments (two normal isolates: LFEE1016 - EPAGRI and MMBF 01/01 - IB/SP; plus control) and six replicates, for enzyme detection. Amylase (AM), lipase (LP), carboxymethylcellulase (CMC) and laccase (LC) were measured by calculating the annulus area, the activity site of the enzymes. Catalase (CT) and gelatinase (GL) were measured by symbols subsequently transformed into scores (1 to 4, from absence to intense production). MMBF 01/01 isolate had the largest areas and enzymes with the highest intensity. Of the enzymes, the largest area was that of LC, followed by LP. LFEEI016 and MMBF 01/01 showed no area for AM and CMC and exhibited weak and equal intensity for CT. The intensity of GT was moderate for MMBF 01/01 (mean score 3.0) and absent for LFEEI016 (mean score 1.0). After production of extracellular enzymes, the isolates were vegetatively altered by temperatures. The assay was in completely randomized factorial design including mycelial discs of the fungal isolates versus three temperatures [23ºC (T1), 33ºC (T2) and 33ºC to 23ºC (T3)] versus four periods (3, 6, 9 and 12 days) and eight replicates in a Petri dish containing PDA and maintained in a BOD chamber. The diameter of colonies was daily measured (mm) in both directions. The noted changes were: innocuous, fungistatic (FS) and fungicide (FC) effect. Statistics was used for temperatures T1 and T3 to verify FS effect and choose the isolates that had higher and lower effect. LFEEI016 isolate showed FS effect at three days at temperatures 33ºC and from 33ºC to 23ºC. In the remaining periods, this isolate suffered FC effect. MMBF 01/01 showed FS effect in all periods. Both isolates statistically showed FS effect. MMBF 01/01 showed higher FS effect at nine days, at the mentioned temperatures, and lower effect at three days. After detection of the change in the mycelial growth rate of the isolates, the production of extracellular enzymes was again verified. The changed isolates were MMBF 01/01 at three and nine days and LFEEI016 at three days. Enzyme production and evaluation were carried out as for normal isolates. MMBF 01/01 isolate - three days, produced the largest areas and enzymes with the highest intensity. Of the enzymes, the largest area was that of LC. Following LC, the area of LP was larger than that of CMC in the isolates. The area of AM was not detected in the isolates. The intensity of GL was higher than that of CT in MMBF 01/01 isolates at three and nine days. For LFEEI016 - three days, the mean intensity of CT was score 2.0 and absence of GL (mean score 1.3). The disease severity should be investigated in the plant among isolates, as well as under natural conditions to determine the evolution of LC compared to the remaining enzymes in the pathogenesis of this fungus in the culture.